Summary
Transcript IDgene_000000814
Gene IDTTHERM_00848090
Length1312 bp
Sequence
AGAAAGAAAGAAGTTTTTAAGTTTAGTTTTGAAGAAAAATGGCTGAAGATAGAAAGAAAATTCAAACCCATCGTTTTTACGAATAAAAGTATCCCAAGGAAAATGACTTGGTTGTCGTCGAAGTTGTTAAAGTTGAAGAAAACTGCTGTTATGTTTAACTTTTAGAATACAACAGAATCGAAGGTATGATTACCCCAAACGAAATGACCAAGCAAATGTAGTAAAGTATTTAGAAGGTTTTAAAAATTGGTAAATAAGAAGTTGTCCAAGTTCTTAGAGTTGATGAAGAAAAAGGTTATATTGATTTAAGTAAGAAGAAAGTTAGAAACAATCAAGATAATGCCTGTTTAGATAGATTCTCTAAGGCTAAGGATATCCATTCAATTTTGATTACTGTCTGCGAATCTCTCCCTTAAGATTGCAGTGTTAAAATTGATGATTTATATACTAAGATTGTTTGGCCTTTATACAAGTTATTCAACCACGCTTATGATGCCTTCAGATTCGCTCTTAACGATGAAACCATCATCACCAAGATTGACATTGCTGCTGAAGTTAAAGAAAAGTTGCTCTAAGTTATTAGAAGACGTTTGAACACTCAACCTATGAGAATCAAGGCTGACTTTGAATTAAGATGCCACGAATACGAAGGTATTGATGCTATTAAGGCTGCTTTACTCGCTGGTGAAGCCAAATCAAGAAATAAATGCGATGTTAAATTTGAAATCATTGGTTCTCCCGTCTATGCTGGTTGCATCGTCACTCAAGACAAAAATTTAGGTATTGAAGTTCTCAACGAAGCTTTGAAGGCTGTTGAAGAAGTTATTATCTCTAAAAAGGGTTCTTACAAGCTTAGAACTGAGCCTAAAATTTATGGTGATAAAGCTCAAGATAACTTAGAAATGTTGGAAAAGGCTGAAGAAGAAGACGAAGATGATGAAGATTCTGAAGTCGAAGGTATGGGTGATGACGATGAAGAAGATGAAGAAAACGATAACTGAGTTAATTGATTTGTTGATCCATAAAATATTTAAAAAACAAACACGTGATAAAATAAATAAACAAAGTGTATAAATTAATTAAATAACATTTTTAAAGCACGGCTATATTTATAAGTAATTGAGTAAGAGATGGTTAATTTAAACATGATTGCTATTAAAACTCAATTTCTTGTCAACTAACATGCATAAATAATCAAGAAATAGAATTTATAAATTATTAATTATAATAATTTTTAGCATTTGTATCGATCTATTTTATTTAATCTTTTGTGTATTAAGTTAATCATTTCTACAAAACTGTCATATTTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-114,968.4 L-213,592.6 L-39,865.1 S-04,462.8 S-35,084.5
S-65,162.3 S-95,293.2 S-125,310.7 S-156,694.7 S-246,228.1
C-05,543.6 C-23,484.0 C-41,778.0 C-61,938.9 C-84,997.0
C-106,827.7 C-126,336.8 C-144,706.3 C-164,042.0 C-184,339.7