Summary
Transcript IDgene_000000857
Gene IDTTHERM_00859220TTHERM_00859230
Length1991 bp
Sequence
AAAAAATTAAGTGCTAATTAATTAATTCACTCACAAACAAATAAATAAATAAAGATAGAAAAGAAGTCTTATTTTCATTCTTAAAGTTTTTTTTGACTTGTAGGTCATATTGTTGATTGAGTGAACAGAAAATAAACAGACAAACCAATTAAATATATAAGGGAAAGGGATTAGAAGAGAAGAAGGTTATTCCAGATTAGATTAGATATTTGTCTTTATACAAAAGAATTAATATAGGTTGGTTTTATGCTGAATCGATAAAGATTTCTTTAAAAGCTCGGTTTCTAAGCTCCAGAAGCTGTTTAAAAATAGATAGACGAGTAGCAAAGATAACAAAATGAATAGTTAAAAAAGCAAATTGAAGAGAATTAAAAGTAGTAATTGAGAGAAAGCATCAATAAAAGTGTCACATCATCTCGAATCGAAGAGTAAAAGGAGTAGCCAAAAACAGCATCTTCAACATAAGGTGAATCCTTTTCATCTTAGAGGGGCAAGCAAGACACAGAAATTCTTGCTCCCTATTAATAGAAACCCCTTCCTTTTGACGAAGAGATTTCAAAATATTTTGATCATCCTGTAATCATGCATGAGGAGAAGGAAGAAAGCACAGCTGATGATGACGACGATGATCGTGTCAACGATTTATAAACTGAGCCTTAGATGTAACACACTGTGAGTATAAAAAAACCTCGTTTATAACTCTCGTAGAGCTTTCTTAACAGGGACGGTGATTTCCTTATAAATTACTATATAAAAGATGATAACTAAAAAATAAGAAACAAGTACATTAATAAGCTCATTTCAAATAAAATTTTGCGCTAAGAGCCTTCAAAAAAGCACCAAACCATGATTATTTTTGATTGGGACGATACTCTTTTCTGCACAAGCCAGTTGCATGCTTAGCGCTTCGAGAACATTACTTCAGATTAGCAAAAGTAGCTTTTGAACTTAGATAAATCAGCAAGTATGGTTCTAAAGGAAGCTTGTCACTACGGAGAGACATATATTATTACTAACGCTGCTCAAGGTTGGGTTGAGTACAGCAGCAAGAATTTTTTGCCTACTGTCTATAAATATTTAGATGAATATAAAATAAAAGTTATATCTGCTCGTTCTTTATACGAAAGCCAATACCCAAATTAATGCCATCAGTGGAAAGTTGAAGCATTCAGAGATATTAAAATAAACTTCGATAAACAGATCATCACTAATTTGATTTGCCTTGGTGATTCACATATTGAAATAGAAGCCGCCCATATGCTAGCAAAGGAATTCGATCAAAGCTTTATAAAAACAGTAAAATTCAAAGAGCAACCAAGAATTGAGGAGCTCATCAAGTAGCAAGACTTAGTTAGAGATAAATTAGAACAAATTTACACAAATTTCAAAAACCTTACAATTCGCTTAGAAAAAAAGTAAAATCCTAAAGAAGTAGCCAAAAAATGAAAAAAAATATTTATAAGCAAACTCCTATTTAGATAAGAAGGATCATTATCACCCACCCACCTACACTTACTTACTTTTTCCTGTTATCTACCTATCAATAGGTCCTTTGATTGTATTAATTAAAGCTATTTAAAATAAATAAATAAAGTAAAGATATAAGCGCCTGTTTAAAATATAATCTGCAAATAAAATTACAAAAGTTAAAATCTTATTAAAAGTATTACTGATTAAATTTAGCTAATCTTAAACTGACTTTTAATTAAAAACAAATAATTGATATTTTTATCAATAAGTCATTCATTCATATGAAATAAAATAAATACATGTTAGAGGAAAATTAGTCCCCACCTTGGAAATAAGGAATAAAAATTTAAATAAATAAATAAATTAGCTTAAGATTCTTAGATAATTTTAATTACATCATTAGCTTATTCAATAAAATTGAGATTATATTTAAGAGGGTTTGCTTTACATATCTTTAATTAATATATAACAAACTAATAAAATAAATAAATAAATAAATAAATAATTATTAAAGGCTTATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,202.9 L-21,869.3 L-32,284.6 S-02,169.5 S-32,826.1
S-62,157.7 S-93,040.1 S-122,452.4 S-152,346.0 S-242,787.0
C-05,368.0 C-24,066.7 C-42,818.8 C-62,506.1 C-82,618.6
C-104,689.3 C-123,672.0 C-142,890.8 C-162,967.5 C-183,012.4