Summary
Transcript IDgene_000000915
Gene IDTTHERM_00895780
Length5709 bp
Sequence
GAATATTTGATTTTTTAATTTATTTATAATAAGTAACAAAATAGCTAATAAATAGTTTGTATCTTAAAAATGGAATAGTATGCAGATAGTCTTTAGACTTTTAAGACTATTTTAGGAGAAGCGTTTACAGATATCCTTAAACATTTACCTAAAAAGTATAAAGATTTTAGAGAGCTAGTCTAAAAAACATAAGAGGAAGTCATGAATGAAAAAGATAAAAAAGCAATCAATGGTAACAAGTACTTTATTATATTTAGCATGGCAATAGGCAGTCATATTCCTCGTTTGTGTTAATCATGCATTCATTACATAGAAAAATTGATAGCATATAGATTTATGGACGGAAACTGCTATGATTATACTTAGGATAAACTATCAATAGATGGCGAGAAAAAAGCTCAAATCGATCCAAACAGAAAGTTAATTGATCAAATTATTGATTCAATATGCGATTGTGTCAATTTAAAAGATGAAAATGTTCATCTGCAAATAATTCGTTCACTGCTAACTATTGCAACAAGCTCTATTTGTTAAGTTCATGGCTAAAACTTAGAGAAAATAATGAGAACTTTGATTGTCATTCATTGCACATCCAAGCAGCCATAAATTTAGGATCCTTCTAAGCACTCATTTACACAAATAATATTAGAAACCTTTAAAAGAATGGAGAAGAATACTCTTCTTTCTTAAGAAGAGACTCAAATTTACCAAAACAAAAAGCAAATAGGTCCTGTGTTTAATCCAAATTCAAGCTCAAGTTATAGAAGCTAAGGAAACTCTAGCAACATTCTGTTGAGTGCCGATTAAAGCGTTTATTTGATGTAAAATCATGAAGGATAGCAATAATAACAACAATAGTAAAACTCTGTACAGATAGATCCTCTTACTTCAAATAATGAATTAATGAATTAAATGGTGATTTAAATAGATGAAGATTAACAAAAGTAAATTATATCTAACTATGTCTCTAAAGTAGTTACCAATTTGGTAGATGATGTCTGCATTTATGAAGATAAAATTAAGAAAATTCAAAGAAAATACATGAACTAACCAGAAAATGAAGTCCAAAAATAAGCTGAAATTAATTTGATTCCTCGTAAGTCAGTTCCTAACATGCAAGATGTAGATACTCCTCAATACAAAAAAACTACAATTGCAAGCATTAAAAATGAAAAAGAAATAGATGCAGGCAAGTTTGGCTGGTGCTTTGTATGTAGAAATGAAGCTTCCAACTTCTGCAAAGATACAAGAGTTCCTATTTGCTCTAAAGAATGCAAAAAGTAACATATGGAGGAAGTAGCTAGAATCGCTAGACTTTGTTTCAAGGGTTAAGAAGTAGCAGTAAATCAATACATTATCGATGCCCTCACAGTTTTTTAATTTTTATGTAAACTTTCTCAAGAAGACCCTAATAATAATTTGAATGCTAACCAATTGAGATAAAAAGTAATAATTTTAGAGCTTATTTTAAAAGTCATGGACTAAGCTGGATCTGTCTTCCTTTCAAGAAAAGAATTCGTTTAAGCTGTCTAGGATAAGTTAGTTCCTTCTTTGCTTTAAAATTGTTTGAGCACAGAAAAATCTGTTTATGGACTTAGTTTCAGCATTGTTGCTAATTTAATTGACAACTTCAGAGAAAATTTAAAAACTGAAATTTCTGTCTTCATAGAAAACATCTTTGTAAAAATATTAGAAAGTACAAACAGTAACTTTTTCAACAGAGTGTACTGCTTGAAAGTCTTTAATAAAATATTTTCAATTCCTAGAGCAGTGATTGAAATGTTTGTAAACTACGATTGCTCAATGAATTAAAATAACACTATTGAACAATTGATAACTTTGCTCACAAAAATTTCTCAGGGAAAGTATTAGAAAGCTGAATTTTAGAATTTAATTCAACCTGAGTAGGCTTAAGAGTTAAAAAATCTATCTTTAGAATGTATTGTATAATTAATGTAGAGCATAAATGATTTTGTAATGATTTGCGATGCTCAAGAAAATCAAGTTGTTTCCAAGAGTGAATTGCCAAGTAAGGAAGAGTAGAACTTATAAACAGAAAACGAAAACAATATTTCCAAAGTAAATAACCAAGATGAAATCAAAGATCCTATTGAAAGAGAAAGATAAATGAAGCTAGAGTTCTAAAAAGGTATTTCTAAATTCAACTTCAAGCCAAAAGTTGGTATAAGACACTTCATATAGCATGGTTTGATTGAAGAAGGAAATCCTAAACATTTAGCAGAATTATTCTTTAAATTTAATAACTAAATTAATCATGAAAAAATTGGTGAAATATTTGGATCTCATGAGGAAAACAACAAGAGAATTCTTGCTGAGTTTATTGAATATCTCAATTTTGAAAATTTAGACCTTGTTAATTCTTTAAGGAAATATCTGACTTACTTCTAACTTCCTGGAGAAGGTGAATAAGTTGATAGAATCTTAGAAAAATTTGGTGAAAAATACTCCTTAGATAACCCAGAATGCTACAAAAATGCAACAACTTCTTACACTCTTTCATATGCTCTTATGATGCTCCACACCTCATCTCACAGCGCACAAGTTTAAGAAAAAGAAAGAATGACTTTGCCCTAATTCATTAAGCTCGTTAAAGGTATTGATGATGGTAATGATTTGCCAGAGTAAATGGTTGTTAATATGTATAATGATGTGAAGAAAAACCCTTTAGGTATTCATCATTTAGAGGCTTCTAAAAAGGCATTCGAAGATGCTTTGACTTCAAGCGTAAGCAGAAAGCATGAAATGTTTTTAAAGGAAACTGAACAAATGTTTGAAAAGGGATAAATGAAAATATAAAGAAAAGAAAACGAGAAATATATTCAAGTTTTTACTAAAGATTATATTTTATCACTTTTGTAGATAGTATGGAGCCCTGTCTTTGCAACTATAAGCTAGGCAACCATGATTGAATAAGAAAAAGAAAGAGAAAATCTTGATTTAATTGCCAAAGTTCTCACTGGGTTTAAAAATAGCATTAAATTACTGGGCTAGTTTGGTATGCTAACTGAAAGAGAGACTTTCGTTTTTGAGTTATGCAGATTAACAGGCTTACTGACTCCTCAAAAGCTAATCCGCCAAAAGAATGTGCAAGCTATTAAAATTATGTTAGAAATATGCACTCAATGCCGTAATTATTTAGGAAGATCTTGGAAGATATTACTTGAATGTGTTAGCAAGCTTGACAATTACTACTTGATTGCATAAAATTTGAGAAGAGACATTGATTTATTAAACAATGACACTTACTTCCAAGATAATAACAACATGCATCAAGATGAAATCGACAAGTATAATAGCTAGGTTATTATGAAATACATTGACATGTCTGAGATCGATAAGATATTCCATCTGTCAAATTAATTTGATGCTGAAACTATTGTTGAATTCATTAGATGCTTATGTGAGTTGAGTAAGGAAGAGCTAGAAAACATTCATAATCCAAGAATTTTCTGTATTTAGAGAATCGGTGAAGTTACAGAATTCAACATGTCAAGAGTGCGTATCATTTGGAATAAAATATGGGATATTCTAAAGGTACATTACAACAATGTTGGTTGCCACAATAATATAAGAGTCAGCTGTTTGGCTATAGACTCATTGAAGTAGTTAGCTGTTAAATTTTTAGAAAAAACTGAACTCGCTCATTATTAATTCTAAAAAGATTTTCTTTCACCTTTTGAATACATTTACTAGAGAAATCCATAATAAAATCTAGAAATTAAAGAACTTATCTTGAGATGCCTTTTCATGATGACAATGAGTAAGGCTTAATATTTAAGATCAGGATGGAAAGTTATTTTGAGAGTTGTCAATTTAACTTTGTAAGAAGATAGTCAGATATTATTAGATTTAGCTATTTAGATTACTGATTTGATTATGAATCAAAAGAATCTTGATAATACTTTAGATGTGTTTGGCGATTTGATTCATGCTCTTACTAATTAAACTAAATACAAAAATGACATGATAGCTTTAAAGGCTTTAGATCATTTGAAGAAATGCATACAATACTTAGTTGAAAACACTCAATAAGAAAAGGATAAGGATTAAGAGTAAAAATAACACAATAAAAATATTACTGCGATGGAAGCCAGTATGACTTCTGAAGCAATTGCTGAAGACGACACAAGTAGTAGACACTCTAAAAACACGAAGCAAAATATCATTATCAATGAATCAAAGAGACTGCTTGAAGGATATTCAATTCCCATCTTAAGCAATTTTGCAAGCTTCTTCAATGACGATAGACCAAAAATGATCATTAAAAGTGTAACTTATCTCTTCGACTCCATTAAGCAATACAGCTACACATTTAATCAAGAATTCTGGAATCTTATTTTCAAAGGAGTATTAAGACCTCTTTTTGATGATATGCAATTTACCTTTTAAAAAAATAAATCTGGCTAGACCGATATCATCAAAGCTACTAAAAATGCTTGTTAGAAAGCTTTCACAGAGCTAGTGAACATTTTCGTATAATAATTTGATACTTTGCATCCTTGCCTCACAGACTTCATAGCTATTATGAATAACAGCATTTCTACAAATTAAGAAATTATTTCTTCGATAAGTTTAAGCAGTTTGAAGACTTTCTTAAGCAGAATAGGTTAGAAATTAAATGAAAATGAATGGAATCTAATTATTGAATCACTATAAGGCCTAGCTTTAAATTGCAAGCCTATAGAAATGCTTGAAGCAAAAAATGCAAGTGAGGACTTCAATGTTCCAATTTAACAATTGCTTAGCAAACCTATTTATAAAGATACAAAATATGATGTGAACATAGATTGCTAAAAGAATATTATCTAATGCGTAATCTTTAAAAATATGGTTGAACTCATTCTCAACATAATTGAAGAGTTTACAAATAATTTAAATGAAAAATAAATCGATAGCTTGACATATATCCTTAAAGATTTCTCTGAATTTTGCGATGAGTTCAACTCTCGTCTTTATCTCAGATTCTACTTATGGAAAAGCGGCTTAAATAGTAAAAATGAAGCAATTCCCGTCCTAGGTAAATAAGAAAAACTATCTAAAGGAGGTGTATTATTAGTGCTTTATGAGAGATATAAAAGAACTTAATCATTAGAATCATTAGATATTTTCCTCGGTGAGACAGAAAATTACTTGAGACAGCTAGAAAATGTTTTGAATGAGATTAAATAGAATAATGAATAATAAATTTTAAAATAACAGTAGTAATAATTATAATAGTAATCATAATCATAATCATAAAATTCAATCAAAAACTCTAAGCAGGGGTTCTCTGAGAATAACACTCCTTAGATGAGTGAAAGAGGACAATAGAATTAAGTTATTTAGAATGTAAACACTATGCACCTAAATGACAAATTATTGAGCTATGCTTACGAGGATAAAGAAAGATAACTCAAGGCTCTTAGATTCATTGTTGGTTCTTACATATTGCCTAATCTTCATGACATAGACCCAAAGGAAATTGGAGAAAGATTGAGGAAAATAGTTAATTTATTATTAGAGGTCAGCAACTAAGATGCAGACATTGATGACGACTTTAATTATAATTTAAAAATAATCCTAAAAAAATACTTTAACTTTGTTTTTGATTTGGCTTCTTCAACTAAAAGATGAAAAAATGTAGATAAAAAAACTCAAAGTTTTAAAAACATTCAGCAATGAATAAATAATGTAAGAAAGTAAATAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,941.6 L-22,086.5 L-31,948.4 S-02,302.0 S-31,467.2
S-61,627.8 S-92,239.3 S-122,956.1 S-153,371.4 S-245,008.2
C-0878.6 C-21,046.9 C-4764.7 C-61,687.6 C-81,488.0
C-101,807.7 C-121,644.7 C-141,223.6 C-161,408.0 C-181,910.2