Summary
Transcript IDgene_000000953
Gene IDTTHERM_00193700
Length2724 bp
Sequence
AAAAATTAAAATCAAGAAAAAAATCAATTAAGATATATTACAAAAGCATAGTATTAACCAATACTAAAATATCTGAAAAATTAGATATAGAACCAAAATTTATATTAGCAAAATGATAGGAAATTTAGACAAAAAAAGAACTGATAAGAGAGTAGTGATTGGTGGCATTCCAAAAAATAATATAGATTTAAGGATACTTGAGAAGCCAGAAAAGTATACTGTAGTATAGAAGAAAAAGACATATTAAGACATTAAATTTATTATTACATGCTTAAAAAACCACTTCGTATTTTACAACTTACAAGACTCGTAGCTGGAGACTTTAGTAAATGAGATGAGCTATTGTGAAGTTAACCAAGGAGAGTAAGTAATCAAGTAAGGAGATGATGCATTTTGCTTTTTCCTTTTGGAAAAGGGAGAGATAGAAGTTCAGGTTAATTAATAGAAAGTTAGAAAATTAAAAGATGGTGAAGGGTTTGGCGAATTGGCCCTTCTATACAATGCCCCTCGTTCAGCTACTTGTGTTGCTTTATCCAAATCTTACTTCTGGATGATTGAAAGAAACACATTTAGGAAGGCTGTTGAAGAAATGATTACGTAGGAATACCAATAAAATAGGAAATTTATAGAAAAGATAACTTTTTTCTAAAATTTGACTTCAAATTAGAAAGACGCAATAGCAGGAGTATTAATTGACCAGCGCTTTTTGAAAGAATAGAATATTGTTAACAAAGATGATCCAGCAAGTTCATTTTACATTATTAAAGAAGGTAAAGTGAGTGTAATGCTCGGTGATAAAGAAGTAAGAACTTTGGGTTAAGGTGAATCTTTTGGCGAAACTGCACTATTACAAGGAGATTAAACTAGAACTATGACTATTAAAGCATTAGAAGACACTACATGCCTTGCCCTAGGAAGAGACGTACTTACAAAGTTACTCGGAGACAAAGTTGAAATGATCATATATAGAAACATATCTAAGTGGGCCTTAGAAAAATCTGATGGTTTCAAAGAGCTAACTATTAACTAACTAGATAAAATATTAGACAGCATATAAATTTCTCATATTACTAAAGGTAGAGTTATTATTCCTAAAGGTACTTAAAAGGCACAACAGTTATACATCATTCTTAAAGGATCTGTTAAGGATGGAGATATTGTTTACTAGAAAAGTTAATTGCTTGGAGCAAAGGAAATTATTAATGCCGACGAGACTTCTGTGTATGAGTAAAATATTGTCACAGAAGAAGATTCAGTTATTGGTTAAGTGAAAATTTCTGACCTTGTTGCAAAGTTAAGTGGAACTTTATAGGATATTTTGAAGAAAAATTAAAAAGTTAGCGAATAGCTTGAAGCCAAAGAATCTTAAATCAGACAAAATATAGAAAATCTTACAATAGACGATCTTGAAGTAGTAAAAAAATTAGGAAATGGATAATTTGGATCTGTTTATTTGGTCAAAAATAAAGACACAAAACAAATCTATGCACTTAAATGTGTTTCTAAATCAAGCGTTGTTGAGACCAGCCTAGAAAAGCATTTAATTCAAGAAAAGAAAGTCATGCAAACAGTTAACTATCCTTTCATCATGAGATTTTTCCGCTCATTTAAGGATGACTACTATATTTACTTCTTACTAGAATTCATTTAAGGTTAAGAGCTTTTTGAAGTTATCAGAGAAATAGGTTTACTTAGTACTTGGGATTCACAATTTTACATTGGTTCTATTATTCTAGCACTCGAATATCTTCATTCTCGAAAGATAATTTATAGAGATATTAAACCAGAAAACATCATGATTACTCACAAGGGATATCTTAAGTTAATAGACATGGGTACTGCAAAGATCATGTAAACTAATGCTGGCACAATGACACGTACATTTACTATTATCGGAACTCCTCATTATATGGCACCTGAAGTTATTTCTGGTAAAGGTTATAGCTATTTAGTTGATCTTTGGTCAGTAGGTATTTGCCTCTACGAATTTATGTGTGGATATGTTCCTTTTGGTGAAGAAGCTGAAGACCCTTATGAAATCTATGAGGAAATTATAAAAAAGGAGATTAATTTCCCCAATTATTTAAGTGATCCTATGGCTAAATCTTTAATGGAATAGCTTTTATCCAGAGTTCCTGAAATGAGAACAGGAGGTTCTTACAGTTCTTTGAAAAGCCATTAATTCTTCAGAAATGTTGATTGGATTAAATTATCTGATATGAATTATTAACCACCTTATCAGCCTTCAAATTAGAGCTATTTAACTACAGAATAAGTTTTAAAGGCGCCTGGAAAGTAAATTCAATAATAAATCAAAGAAGAATTTGGAGCTCTTAAATTACCAAATGCATCTAAAGTAGTCGATTGGGACAAGATCTTTTGAAGATAATCGCTAACTATTTTAAACTATTCCATTATATCAAAATTTTGTTTTTGATGAAGTTTTTTCTAGAATTAATATTTAATAAACTTAAAATAAGCAACAAAAATAATTATATTACACTTTTAAATAAAACAATAAAAACCTTATTAGGATTTCTAAATCTATTAGTCAAACACAAAAAATCAAACAAACAAACCAACAAAAATAAATAAATAAATAAAGTAATAAACATAGCACTTGATTACATTATAATTAAGCAAAAACAAATTAATCAAAATTAAAAAAGATTTAAATAAAAATATTTTATTTTTAATAAAGTAATCTAAAATAAACAATTAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,181.6 L-26,097.4 L-35,637.6 S-07,296.4 S-35,976.6
S-69,106.0 S-99,491.4 S-127,731.3 S-157,561.2 S-247,893.5
C-08,021.4 C-220,680.4 C-410,199.4 C-67,051.4 C-87,424.9
C-109,048.8 C-129,955.8 C-1410,659.9 C-169,435.7 C-1811,543.9