Summary
Transcript IDgene_000001026
Gene IDTTHERM_00194680
Length1138 bp
Sequence
TTTTGCAAAAAAAAAACTTAGTAAAATTATTGAAATTTTAAATTTAAAGCATATAAATGATTGAAGAAAAAATGGAAGAATAAAAAGAATTTGTTAAATGTATTGGGCAATTGAATGGTCATACTGATAAGATATGGTCAGTTTCATGGCATCCTACTTTAGATATATTTGCAACTTGCAGTAGCGATAAGACCATTAAAATATGGGGATTAAAAGAAAATAGTGAAAATTAGTATGAACTGAAGTAAACTATCTCTGATACTCATGAGAGAACAATTAGAACATTAGCTTTTTCTCCTGATGGAATGATGCTTGCATGTGGAAGCTTCGATAGCACTATATCTATTTATGCTCTCAATAATGGTTCATTCGAATTTGTGTCAAAATTAGAAGGACACGAACACGAAGTTAAATGTGTAGCTTGGGATTCTGAAGGTAAGTTTTTAGCATCTTGTTCGAGAGATAAGACCGTTTGGGTTTGGGATTACGAAAATGGCTTTGATTTTTCATGTTACTCTGTTATAGATGCACATACTTAAGATGTTAAGCACGTGAAATGGATTCCAGGTACTAATAATTTAGCAAGTACTTCGTTTGATGATAAGTTAAAATTATGGGAGTAGGAAGATGATGATTGGAAGTGCTCTGCAACCTATTCAAATCATTCTGCTACTGTATGGTGTGTAGAATTTTCCAAAACCGGATAATATATGGCCTCCTGTGGTGACGATAAATAAATTAAAGTTTACAAAAAAAATGAAAATGGAGCTTTTTCCTCCCCTTATATTGTTGAAACTACTATTAAAAATGCCCATGCAAGAACTATTTATAGTTTATCTTTTAGCGAAGATGCAACTTTCCTTGCTTCTGTAGGTGCTGATAATACATTAAATGTTTATTAAAAAAATATGTATGTAACAACATTTGAAGGTTAAGACAACAATTTATACGAATTACTAGAAAAGAAAGTAAATTGCCATTTTGCAGATATAAATTGTGTTGCTTTCCATCCAAGTAAGGATATATTGGTTACTGTAAGTGATGATAGACAAATTAAGCTTTGGTCTGTAGAAATAAACTTATGATTTAACTCAATAAATTCATATATTAATTTGTCTTTAATATATAATAACCTCAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,127.0 L-21,056.8 L-3941.3 S-0418.3 S-3787.0
S-61,068.0 S-9883.4 S-121,290.7 S-151,409.5 S-24961.4
C-0778.1 C-22,860.3 C-41,035.6 C-62,818.4 C-8822.8
C-10468.0 C-12319.1 C-14437.0 C-16868.2 C-18881.2