Summary
Transcript IDgene_000001147
Gene IDTTHERM_00926990
Length652 bp
Sequence
AAAATTCTTTAAGATTATTAACAAAAAATAACACATATTACTAATTTAGTTCATTTAAAATGGCTGACTAAAAGCACGATTAAGTTGTTGACCAAGTCCACAAGAAGCTCAAGCCCAATGAGTTGATCACCACCGTTAATACTGATAAGGCACCCAAAGCAGTTGGTCCTTACACCTAAGGAAAGATAGTTGCTGCCGGAGCTAGATTATTCTACGCTTCTGGTCAAATTGCTATTAACCCTGAAACTAACACTTTTGATGAGACCTCCTGCGTTGTTTCTCAAACTGAATAGGTTTTGAAAAACTTAACTGCCGTTTTACACGAAGCTGGTACTGATTTGGAATACGTTGTTAAGGTCAACATCTTCTTGGATGATATGGATAATTTTGCTAAAGTTAATGAAGTTTATGGCAAGTATTTCACTGGTGATAACAAACCAGCTAGAGCATGTGTTGCTGTCAAGACTCTCCCTAAGAATGCTAAGGTTGAAATCGAATGTGTTGCTGTTGTCCCATGAGGTCAGTTAAAATAAATGAATTCATACATACATAATAGATTTAATTAATCAATTACTTGTTTTTTATTAAGTAATATTTTAACAAAATTATTTCTGTTAATATGCTTTTTTAAAAACACTTTTGTCTATAGATG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-115,855.6 L-215,847.6 L-317,218.6 S-06,967.7 S-31,310.5
S-61,328.5 S-91,057.1 S-121,507.9 S-151,645.8 S-241,093.1
C-0240.4 C-2620.5 C-4549.7 C-6596.3 C-8509.7
C-10932.5 C-12688.7 C-14562.9 C-16657.4 C-18537.3