Summary
Transcript IDgene_000001263
Gene IDTTHERM_00939020
Length2942 bp
Sequence
TATAAAGAATAATCAAAGGTGCTTCTGACCTTAGAAATTATAAGTCTATAACTTTAAAAAATAAACTTTAGTGTTTATTAGTTTCCGATGAGAAGGCTGATAAATCATCAGCAGCCATGAATGTTAATGTAGGTCACTTATAAGACCCTATTGATAGACCAGGCTTAGCTCATTTTTTAGAGCACATGTTATTCATGGGAACTGAAAAATATCCAAATCAAAGTGAATACAGCGATTACCTCAGTAAAAATGGAGGCTATTCAAATGCTTACACAAGCTAAATGGAAACAAATTACTATTTTGCATGTTAAAATAGTTCAATTGAAGGTGCACTTGATCGCTTTTCTTAATTTTTTGTCAAGCCTCTTTTCAGTGAAGCTTGTGTAGAAAAAGAAATGAATGCTGTTGATAGCGAACATCAAAAAAATATTATGCAAGATTCATGGCGTTTCTTACAACTTTTCAGAAGTTCAGCTCATAAACACACTGAATTCTGCAAATTTGGAACAGGAAATTTATAAACATTGAGCCATCCCACAATCAGAGATGATTTGATCTAATTTTATAACAAATACTACTCAGCAAATTTAATGAGATTAGTTATTTATTCCAACAAAGATATTGCTTAGATGGAAAACTGGGCCTAAAATTATTTTTCTGATATTCCTAACAATGATTTACTACCTCCTTCTTTTAAAGCTTTGCCTTTCACATAGGAAAATTTGGGTAATTTATGGAAAGTAGTTCCTATTAAAGATATTCATTAACTTTCAATTAAATGGATTCTCCCTGATATGAGAAAGTACTATAAGAATAATCCAGCTTCTTATCTTTCTCATTTGTTAGGTCATGAAGGAGAAAATAGTTTATTGAGTATTCTGATTAAGAATGGATTAGCTGTTGAGCTCTCAGCAGGTAACTAAAATGAGTAGAATTTATGGAGCAGTATGAATATTGAAATTTCTCTTACTAATAAAGGTGTTGAGAATTATGAATAAGTTTTATAATATCTATTTTCTTATATTCAGATGCTTAAAGAAAAAGGTGTTCAAGAATGGGTATTTAATGAGATATAAATGTTAAGCAAGTTAAATTTTGATAACAAAGATAATGAAAAGCCTGAAAGCTATTCTCTTTCTCTTGCAAGTCGTATGCAGTACTATCCTATAGAAGAAGTCCTCGTTTAACCATACTTAAACGAATAGTATGACAAGAATTTAATTTAAGACACTATTAACTAATTTAACATCGAAAATGTTCGTATCACTCTTATTTCTAAGAAATTTGCAGAAGAATGTTAATTAACTGAGCCAATTTATGGAACTCAGTATTCAGTCGAACAAATTAATGAATAACTTAGAAATATACTTTTAAATCCCAAAATTGATGTTATTCATGATTTAATTAAACCTAATACTTTTCTCCCTAAAAACATGGATTTGTTTACTAAGGAAATCGACACATTACCTTAATATCCATTCTTAATTAGAAATGAAGAATTCTCAGAGGTATGGTTTAAATAAGATAATCATTTCTAGAAACCTAAAGCAAGTGTAAAAGTAAAAATCAGCTTCAATTAGCAAACAAAAGGTATCAAAAATTAGATTTTATTCGCACTTTGGATATCTTTATTAAAAGAAGAAATGAGAGAAATTAGTTATATGGCTGAAATGGCTTATTTAGGATAATCACTCAATGTTGTAGATGGTGCTCTTATTTTGAGTGTTGGTGGCTATAATGATTCTTTACCTTAATACCTCAAATAAATTTTCACAATTATTTCTAATTTTAACTAAACTGATAAAACTAAATTTGACATATAATATGAGAGAATCATGAGACAATACTAAAATATCTCAAAAATGTAGCCATATTAGCTCATTTTTAACTATGCTCAACCATTGATTATAACTAATGGAATAAATCCAGATGAGTTGCAACCTACTCTTGAAAAAACTACTTTTGATGAATATTTGGTATTCTAAAAAAATCTCATGTAAAAGCTTTCATTTTAGTGGTTAATTTAGGGAAATATGACAGAAGAAATTGTCAAAAACTTTACTGTTGAATCAGAAAACATATTATTTTAAGCAAAAAATGCCACTAAGCTTTCTCCATCTGAAATTTCTGACATTAGAGCAATCTAATTACCTCAGAAAACTATGTTCTGGGAAAAAAATTTAGGCTCACATGAAACAAACTCAGCAATAGTTTCATTGTATCAATATAAAAAAGATACAATATAAAATGAGCTTAAGATGCAATTTTTGGCAAATATAATAAAGACACCCTTCTTTGAAAAACTCAGAACAGACGAACAACTTGGTTATGTTGTTCATAGTTTGTCTACAACTACAAGAGCTGTTTTAGGGTTCATCTTTATGATATAATCGAATGTTAAATCTCCTTAATATTTATCATAAAGGATAGAGCTTTTCTTAAATAACTTCAAAGAAAGAATGAGCAATATTACTGATGCTGAATTTGAGTAGTATAGATAATCAATTATTTCTAACTTAAGCTAAAAACCAAAAAGTATTTTCGAAGAAGCAAATGATAATTGGGATGAAGTATTAAATAATTAGAGACTATTCAATAGAAGAATTCAACTTCTTAGTGAAGTTAAAAATGTCACATTACAAGATGTTCAAGAGCTCTTCAATTAAATTTTCTTTGAGGAAAAGAAGAAATTAGATATCCATTTTGTTAGCAATAACCATTTAGAAGAAAATAACAAAATAAAAGATGAAAGACTTAAAAACAATGAGATTGAACAAGTTCAATCAGTAGTTGGGTTCAGAAACTCTAGTTCATTATTCCCAGATTTTTATTCTAGACTTTGAACAGTTTTTCTTTTGTAATTCCAAATTTATTTAAAAAATTAAGTAAACTTTATGTATTTATTTATGTAAGTATTTAGAAATATAAAGCTAAAATTATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,109.2 L-2958.9 L-3567.4 S-01,280.6 S-3320.6
S-6224.4 S-9205.7 S-12292.5 S-15237.9 S-24384.5
C-0288.5 C-2146.9 C-4153.3 C-6209.9 C-8214.4
C-10274.6 C-12340.2 C-14305.0 C-16341.8 C-18369.0