Summary
Transcript IDgene_000001270
Gene IDTTHERM_00939230
Length977 bp
Sequence
GCAGAAAAAGTTAAAATTTCAGCTAAAGCAAGTTATAGTTTTTAAGTTTAAGGATCTTGAGCGAATCTAAATAGGTTAATAAAGCTGTCCAGATGGATGCCCCTCCATTAAATGAGGAGGAATTGAATTAAATTTATAATTGGATTGACGGAATCCCTCTTTCTCGTCCAAAAAAAAATATAACTAGAGATTTCGCAGATGGGTGCATGTTGGCTGAAGTAATAAGCCATTATTGTCCCAAGTTGGTTGAAGTTCACAATTATTCTCAAGCACACTCTGTTACATAAAAGCTCTACAACTGGAATACCTTAAATTAAAGAGTTTTAAAGAAAATGGGATTTTAGATTTCTAAAAATGATATAGACTGTATAATAAACGCAGTCCCTGATGCAGTTGAAAGGGTTTTAAAGGTATGTTAGATTAAACTTGATAAGTATCTTGACGATCAAAAGAAGAAAAAAGATTAGCAATAATATATAGAAAACGCATAAATGATGTAAAATGGTAATAAATTACAGCTTGGAAATGCCAATAATCCATATTAATACGCAGAATTTTTAAACCCTAAAGAAGTATCATAAATGCTCTTTTAAAGAGATACAACTATTAATGAGTTGAGGGCAACTATTGAAATACTTGAACTAAAGATCAAAAAAATGGATTAGCTAGTAAAATTAAAAGATAGTAAAATATAAAGTCTTATAAATAAATTATCTTAAGCAGGATTATCCTGAAACTAGATAAATGAATGATAACTAAATGCTTTACAAGAAAAGATGCAGCAACAAAACACAACACAACAAATAAAAATAATAATAAAATTTTCTAGATAAACTAAATAATTTAAAATTAATATGATTAATTAATGAATGAACAATGTTTGCATTTAAAATTAAGAAAAGTGAATCAATTTACTTTTCTTTTGTAGATTTATCTCAATTTGTTTTTATAATATATTTTATTCCCTTAAATAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,634.1 L-23,756.6 L-33,452.9 S-04,109.8 S-32,412.4
S-63,081.3 S-92,116.6 S-122,522.8 S-152,749.0 S-242,469.7
C-01,754.8 C-2654.9 C-4761.3 C-61,578.8 C-81,342.9
C-101,596.7 C-122,179.1 C-141,845.0 C-161,658.9 C-181,563.9