Summary
Transcript IDgene_000001332
Gene IDTTHERM_00954210
Length1701 bp
Sequence
CAAAAATAAATTTGTTTAATTAGAATTAAAAGTTAGTTAGAATATACATATATAATTAATTATGTCATTATAGGAATACACATAGGATTTAAATAATCTTTGCAATAAATTAATTTAAGTATAAGATTTAAAGTTATTTGTTGAGAAATACGGTGTTAAAGGAATAGTAGGAGCAGGTTATTTAGCTATAAATAATAAAGATACATACATTAAATCTGAAAGAGTGATTAAGTAATGGATTAAAGATGAAAATCTTTATGAGAAATTTTTATTTAGCACTGATAAAGATGACTAAGAAGTAGTCAAATAGATGCTCTTCCATTAATAAACTCATGTAAGAACTCTTGTTTCTGAGTGCATAGAATTTCATGCATATGATATTGGCTTATTTTTAGAAAGAAATTAATAAAATGAACTCTATCAATCTTACTTGCTAGTTCTTATCCATTTATTAGCTGATTAAGAAACAGAAGTCGCCTTAAAGATTTTGAGAGCGCTCAAAAAAATGACCAAAATGGAAAACAATGTTTAATTTATGGAAGATGATTTCTGGCTTTAGAAGGTTGAAGAAGGCGTTCAAGCAGCAGATGAAGTTGTTGCTTTAAGATTTATGGAACTTATTGTTGCAATGTCAAATACAAATGAAAGAATACACAATAAATTAGTTAACAAAGGTTTGCTAGAAAAATCTATACAATTATATCAAACTGATGATTTGCTTGTGAAGTTAAATGCAGTAGAAATATTTTCTTATTTCGGAGAGAAAGATTACAATTCAAAATATCTTGCTGAACATAAAATTACCTAATAAATTATTGCAGAGGCCTTCAATTAAAAAGAAGAATTGTATATTAGAAAATACTCTATGTTGCTTGTTGCTAAAATGATAGCAAGTTCTGTTATGAAATTGACTCCATAATTAGCTAAAGATACTCTAGCTTTTATTCAACAGCTTATCCAATCTAAATTATAAGAAGAAATATCATCTGCATTTGAAATTATGTCCTTCATTTGCATCAAATAAGAAGGAGTAAATTTAATTGTAAAAGATAAGATTGTCCTTAAAACTCTTTTGGACTATACTTCAAGCACTAAAGTCGAATTAAGAAAAAAATGTGTGAATGTATTTAGTCATATTCTATTTACAAATAGTTCAACCCCAAAAAACAAAAATACTGTGTTTAATTTATTGATGTGTTTTGGTAACTCCTAAATGGCAAATTAAATAATAAATTTTGAAAATTAATATGAAAACCTAGATTAGTTGTAAAATAGCTTTAAAGTTATAGAATAAAATCTGTTTTCTCCTTTCGAAGATATAGAGCTAGATTACATGCTTTTACTTAAACATTGCTTCTTATATGAAGAAATATGCTTCTAGTATATACAAACACCTAAAAGTATAGAATACATGACATCTCATCTCTGCAAAAATAAACTAATCTTTGATTTGAAAAGAGAATTAAGAGATACTCTCATCGCCGTTTGTAAGAAGAACTCTAAAAATAACAAACTCTATGAAGTATTTATTGATAACTATTATAAAGCCTTACAAAATAAATCCAATCCTTCTCAAGAAATGCAATACGAATCTTCTACTTTATGAAATCCTCTAAATAAATTTATAGAATTAGAATCATTCTATCTAAATTATATATTCAGTTTAATTTTGTATTAATTAATTATAATATTCTAAAAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,750.3 L-21,269.8 L-31,271.6 S-02,734.1 S-31,002.6
S-61,179.4 S-91,135.2 S-121,763.4 S-152,088.3 S-242,118.6
C-0310.7 C-2536.6 C-41,735.7 C-6794.9 C-81,019.5
C-101,156.3 C-121,155.0 C-14877.1 C-16845.7 C-18880.9