Summary
Transcript IDgene_000001356
Gene IDTTHERM_00958790
Length1243 bp
Sequence
GGATATAATCAGCTAAAATCTTCTAGGAACCTAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCAAAATAGGAAAAAAGTCAAAGAGATGTACAGAATGAAAGGTGTATAAATGCTCGATAAGCCTGAGTTAGTCATTTCTGATATCTAAGAACCTAATATAAAGCCTTAATAAGCTTTAATTTATTAGACTATGAAAAGCGAATTAACTAAAAAAGGCTACTCCGATTTTAGATTTTTAGGACAGGGAGTATAGGGATTAGTTTTATTAGCAAAAGATTCCAAAACTAAAATGAGGTATGCCATCAAAGGTGTTTAAGTTAGAGATCCTCAAGGAAAACTTGACGAAGATCTTAACAATCAAGTGAAGCAAGAAGTAGAAATACTCAAAAAATGTAGAGACTCTCCTTATGTAGTCAGTCTTATAGATTAATTTGAAGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCAACTAAATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATATCAGCAATCAAGTATGCTAATGACATTGCTCAAGGTCTCTACTACATTCACTCGAAGAACTGCCTTGTTAATGATCTGAAAATGGATAATATCTTAATTGACTATCATGGAAATGCTGTTGTTTCTGATTTTGGTTTGGCAGATAACATAATAAATAAATCTGGCTATACTAACAACCAATATATGGGAAACTTGTTATATCAAGCACCAGAGTGTTGTGACCCATCTGATCCATACATAGGTAAGGTTTATCATGATGAATATTTAAAATTAGGCATCACTGTGAGACAAGAGCCAAGCAACAGAAGTGAAGCATGTTCTTTAGGATATCTAATATATACATTTGTCTAGGGAATAAATTTCAATTTAGCATCAAATAAGCACAAACAATTAAATTTTAATGATGAATTTAAAAATTTTGTTTATCACAAATAGCTTAAATATATTATTGAAGGATTAACTAATTTTGTTCCAAGGAATAGAATGCCTATTAAGGAGGCTTTAATTATTTTAAAGGGAATTATTTCTTTTGAATTTTAGTTAGATGACATGCTTATTGAAATGATAGATGGAAACACTCAGCAATTCACAAGTTCACTCAAAAATGAAATTGAGTTTGTTAGAGATTTGTCAAATAAGTTTTACCCAATTATTAAAAATGAACAGACCTTAAACTTAGAGTTAATAGAAGATCATCAAAAAAGACAATAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,277.4 L-2631.0 L-31,909.8 S-0776.0 S-31,839.3
S-62,367.4 S-91,299.1 S-122,679.6 S-152,568.4 S-242,368.7
C-01,934.7 C-2914.2 C-41,238.7 C-6384.0 C-81,029.2
C-10899.9 C-12992.9 C-141,454.0 C-161,888.0 C-18989.9