Summary
Transcript IDgene_000001494
Gene IDTTHERM_00997610
Length1082 bp
Sequence
AAAAAAGATCTACTTATCAAAATAGGTATTAACATCATGAGTGCTAAGAAAATAGCAAGGGATCTCATTTTTTCAGGTATTTAGCCAACAGGAAAGCTTCATTTAGGAAATTATTTGGGTGCCATTTAAAACTGGGTAAAACTACAAGAAAAATATCATGAAAAATCAGATATTTTCTTTTGTATAGTTGATTAGCATGCACTAACCGATAAATTTAAAATAGATCATTAGATCTACTTTGAAGATACAACTAAAGATAACACTATTATAATGGCAGCTGCTTTATTAGCATCTGGAATAGATCCCAAAAAATCTAACATTTTCGTTTAATCAGCTGTTCCTTATCATGCAGAGCTTTAATGGATGTTAGGATGTATTGCTCCTCAAAATTGGTTAAATACAATGACTTAATATAAAGATAAAAAATCAAAAAACTCTAGTTTGGGTTTATATTCTTACCCTGTTCTCATGGCAGCTGATATTTTACTTTACAATGCTACTCATGTTCCTGTTGGAAGCGATTAAAAGCAGCATTTAGAGTTAACTAGAGACTATGCTACAAGGTTCAATACATTATTTAAAAATGATAAAACATAGGGTATTTCAATGCCTTAATACATAGAATCTGAATTTCCTAGAGTAATGAGTCTTAAAGATGGTACTAAAAAAATGTCTAAATCAGATCCTAGTGATTTTTCTAGAATTAACTTGACTGATACTCCTGAAGTAGTTTATGACAAGATCAAAAAAGCTAAAACTGACTCAATCCCTATTGTTAAATTAGATCCAAACAGACCTGAAGTAACTAATCTTATTAGAATATATAGCTCTTTATCTGGTTAGAGTATCAAAGAAATTGAAGCTACTTTTTCATCAAGCTCTATGAAAGATTTTAAAGACAAACTCTCTGAGCTTATTATTACAAAAGTTTGCCCAATTGGTTTAAGAATAGAAGATCTATTATCAAACTAAGACTACGTTTACGAGTCTTTAAAGCAAGGTAACGAAAGAGCTTACGATAGAGCCAAAGAAAATATTCAAAGAATAAAAAAAGAGATGGGAATGTATGTTATGTGATGGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,976.0 L-23,127.8 L-32,371.5 S-0834.6 S-347.1
S-652.3 S-963.2 S-1259.4 S-1596.5 S-24113.9
C-0133.2 C-293.7 C-450.3 C-647.8 C-8103.9
C-10173.4 C-12171.7 C-1491.7 C-1667.8 C-1846.0