Summary
Transcript IDgene_000001517
Gene IDTTHERM_00225630
Length3982 bp
Sequence
TTAAAAGTTAGTTACTTAGTAATATTTAAAATAAATGCCTCCTAAAAAATCTGGATAAAGCAGGGGAAACCAGCGTTAGGCAAACTAATAAAAATCAAAGCCAATTTCAGAGTATACTGATTATAATTTATATGAGTAATTATCAAGAGAAAATTGTTCGATTGAAGAGATTTTAGATCAAATAAAAGATGTAGATGATTAAGAAACAAAAGAGAATATCCTATAAAACTTTGTTCAGTTGATTTTTAAACTAGTAGGACTCAATAGTTTTGTGATAAAATTAGAAGACAAATAATTTTCTTCTATTGATTAGGATTTTTTCAAATCAGAAATAGAATCTAATTTAAAAAATGTTAAGGATTTTAATTGGGTTTTTACTACAAGAAAAGAAGAGCACTAGTTCCTCAAAGACAATCTCTTTATTTTCTTTGACTCAATTTTATAGCAAAGTCAATATTACAAATCAGAAAAAAAGGATGATTCTTTTATGGTAAATCTCTCTAATTTCCTAATTATGTTATCAAAATCCCATATTTAGAATGTAAGATAGAATGTATTGAGATTAGTAAGGATTATAGTTGAGTAGGGCTTGATTAGAATAGAGAAATTGAGGGCTGCTTAATAGAGAAAATTATAGAAAGAAGAGCAATATTTAAAAAACATTCTTGAAAACATTATGAATATATTGATTAAAGGTATTTTCCATAGTAGAATTTTAGATAAGAGTCAGTCAATATAGCAAGATTGTATTGAATCTTTTGAGATTTTCTTTAATATTTCTCCTTAAATGACTTTGAATTCTTAGAATCTCATTTAATTGTGTTATTTATTTGATTCTGATATTGATCTCGCTAATGCACTCTTAAAAGTACTTATCAATATAAAATGGAAAGAAACAGAGTCATCTTTGGAGGCTCTTAAAGAGTTAGTTCAATATGATAAATTCAGGAAGAGATTAATTTATTTTTCTAACATTTCAACATTTGTCACAAGTTACAGAGCTATTCAATTAGTTAACCTGATAGATGAAATTCTACCTGGATCACTCAACAACAAAGACTTAAAAAGAGCAATGGCAACTATCTTCCATAAATATGAAGAAGTCAGAGCAGAGGGATTTAAGATTCTTTAAAAATTTTTAGAAGTTAATGAGGGTGAAAGATAAATTAGCGTCATAAATCTCGAAGGAGGCGAAGACGATGGTGTTAGCGATATTTTCTAGTTCAAATAATAAACCAATTCTTTAGCCTGTTAAACTTTTATAAAGAAATTTTATACACTTTTGGATGAAGTGGATTCCAAAATTTATGAAAAAGAAGATTTGATCTAAAATATGATAAATTCTCTTGGTTTTGAATTTGGTGCTATTTACGATTTCCAAAATATTTTCCAATTGCTAAATTAGTTACCATCATCGAATTTAAAAGATAAAATTTTTGATTTGTTTAAATTGATTGTTATAATTTTGAAAAAAACGATGAAATTCTTATAGCTAATATCGTAAGGCGAGAATCCATCGAGCATTTACAACCAAAAGCAATCAGAAAAGTTGCTTATCATTAGAAATGAATTCTTTAAAGCCTTGGTGGCTAATTTTGATAACTTTTATGAGAATATGAATAAACACCCTATCTTAAAAGAGTATTCTTACCAATTATTGCTATCAATTCCAGCTATAGACCTCCAACAGAATTTAAAAGAAACCTAGTTCAAAACAATATCAAAGAAAATAGCTGAAGACATACTAAATACAATACTAAACTAAGATTCTTTCATTGAAGATAAATCTTAATCTATGGGACTTGTTTTTGGATGCGTTAGCACCCTTTAATACTTCCTCTTACACACCCCAAGGGCCTACATCGATCCTTTTAAATAATGCAAGGAGAAATTGATTAAACATGCGATTTTAGATTGTACTGACAATTTACATGAAATAGTAGTTCAAGAAAAGGAGACGTCTTTAGATTTGTCTTAGCTGTAAGAAGAATATACTTATTTGTTTATTAAATTGTTTAGCTGCACCAATCTCTTAAATTAATTGGATGAAATATATTGTGAAAGTTTTATATAAAAGTGCTTAGAAATCACTGATACAGCTACTTCATATACTTCAACTGACAACACTTGCATTTATACTTTTACTAGTTTAGGGTTACAATTAGACTTTTACTTGAACGTATTGAGAGTTGGATTGTCTGAATCTTGCTAAAAAACTTCAAGACTTGAAGAGTATCTTAAGTATAGGTAAAAAGTTATCAAATAGCTCTGGCTCTTCCTTAGAGAAGAGAAGAAGAAGGCAATTTAATTTAACTTAGAAACCTCTGAATACAAGAAAATACTTTTTAAATCTTACTATTCTGTCGTTGAAGGACTTGCTTTTGTTTGTAATTAAAAGCTTAAGCACTTGCCTATTTACATAAAGCTCCATTCCGACGATCCCTTATTTACTTCTTTGATTGATTATATTAGTTACTACATTCCTTAGGGTCAGATAGGAGATGAAAAGAAATTAGAATCAAATGAAAATAGCAATGATCACTCAAATAATAATGACATAAAAAACAAAATAATGGAAGCTGAAAAAGAAGATGAAAATAAATTGAAATTAAAACCATTTGAAGAATCTTATTTATTTTAATAACAATATCAAAATCAAAAGTAAATTTCTGATATTCAGATTATCTTACTTTAATTCTGTAAGTTGACGCTAAGCAATCCTAAATTTATTCATTCTCAGTTTGGTGTTTATATTTTTAAGAATTTCTTTGATTGTCAAAACAAAGAAATAGTTGATCTTCTCAGAAAGAATCTAGCTTGCTGTCGTCTTTAAGGTGATAAATAGTCAGGATTTCCTCCTTTTTGGAGAGCTTTTGATGAAATAGTGAACTAATTATTAGATGAAGGCAAGGATATGAGTGTGATTAAAAAGTTTGTAGTTTTTACTCATAAATCATATTTCTCAGAAACTATAAATGAAGGCAATGTCCAAGTGAAACCTAAAGAACATTTTAAGGAGCTCTGTGAAAGGTAAATTTATTTCCTGACAGCAAAGACAGCAGTCTTAATCAACACTCCTAATAAACTAAATACACTTAATGCTATTGGATATTTGCTTTAAATTAAGATTAACTACCCAAAATCGCTTGATCCCAACCATTTGATGTATATCCAATCGCTTTAAAAGAAGTATCAAACATTCTTTTTGAAAAAAACATAAGACTATGTGCAAGAATTTAAATAAAATAATCAACATCTCTAATCTCTAGATGAAACAATACTCTCTGAGAAATCTAAAGAGATTATTTACAGATATGTTAAGAACCTAGAATCATGGTCTTAGGTTAAATTTAATGTAGATCCTTATGGAGAGGGATAAGAAGCTCTCGAAAAGTAAAGAGAGCAAGCAGAGAGAAGTCTTAAAAAAGAATAAAAGCAAGAAAATGCTGATGAGAAATCTGATTTAGTAAGTGAAAGTGAAGATGAAGAAGTTTAAGATTAAGATTAAGAGGAAAGTGTAGAAGAAAAGAATAATACAACTGATAAAAAATAATCACATAAATCGAAATAAGTAAATAAAAAAACAAGAAGCAGCAGTAGAAGTTCATCTAAAAATTAAAAATCTTCAAAAAAAATGGACGAAAATAAATAAAAACCCACTTCATCAGTTAAAAAAACAAAGAAAGAGCAAAAATCATCAGTTAAAATAAACATAAAATAATAATAAGAAGAAAGCAGTAAAGTTGAAACTGTTAAAAAAAATCATAGAAGATAAAAGAAGAATTGAATAATTTAAAATATATTTATTTCATATATAAATGTGTATCAATCAATAGTATAGTATAGTGTTTGTTGTTTTATTTTTAATAGTGTTGTAAATATATTGCGATTTAAAAAAATATTATTTACAATAACTACTTTTTCCAAGCATGATTTTATTTAGATGTTGCAGTATGTTTATTTATTAATACATTTGTTAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1275.6 L-2263.9 L-3325.0 S-0122.2 S-3282.5
S-692.6 S-9106.7 S-12109.7 S-15147.0 S-24200.2
C-061.9 C-25,257.6 C-42,550.0 C-617,882.2 C-86,152.0
C-102,394.5 C-121,824.0 C-141,293.8 C-162,280.0 C-18923.6