Summary
Transcript IDgene_000001622
Gene IDTTHERM_01030000
Length3959 bp
Sequence
TTTTAAATAAGTTGACTAATTATTTTCATAATTATTCAGCAAAATTTGATATCACAAGATAAAATCCACACAGAAATTCATATTAAAATGGATGAAATATTGTAGTAATTTATAGATAGCAAAAGATAAGCAAAGAAGATAGAAGATTTTGCAGACGCTGTATCATGCAGTGCCACAGAAAGCTTAGAAGATTAGGACTAATCTTTTGATAGAGGTGCTGATTTCAACGATGGAGAAGTAGATGATGCTTTATTGGATGAACTTATAGAATATTAAACAAACAGAGAGCGTTAATCAATTACTGAAGAGTAAAATGATCTCATGAAAACTGAATTGTAAAAGCCAATAAGCAACAATTTAAATAAAAAATAACCAACTAGCTTGAGCGGTTTGCAAAAAGGGTTAGGAAACAAAATATCTGGACCTTCTTATGATTTTAGTAACTCTAATAATATGTAGACATTAAGCGGCATTTATAGTTCAAATTCTAACAATAACTCTTAGAACAGCAATGAGAACTTTAATTTCAATAGACAAGGAAATACTACTCTAAAGCCTACGGGTTTTGATGCTATCAAGCTTAAAAAAAATTAGAATTAAGATTAATAGTAATAATAATAGCAATAGCAAGTTCTGAAATTTGTAAATTAAAATAGTAATGGAGGGATTTAAGTAGAGGCTTCTTTAACAGATAAAAGAAGATAAGTAAATAACTCTAATGATATTGATAGTTTCATGTTGATCAATAACGGATAAAAAGAAAAAAAGACAAAAAATTAAAATTCTAAAATAAGTGAGTTGCTTGAGAAGTACAAAGTGATAGATTCTAATTCAAATACTTAAAATTTCGAGTCTACTTCGCTTAATACTTCTCTCAATACCAAAAATAATAAATTAGAAGTTAAAAATGGGTTTTAAAATTTACCACAAAAAACTGAAAAAATAGGGCTTGCAGCCTAAGCTGTAAATCAAAGCTCTAACGTACGTTCTAATTTTACACCTCCTACAATAGTCAATAGAAATAATTGGACAAATAATTTATCCAATGGGCCAGGTAGTGCACTCACTGCATCTTCTACTGCAAAAAAGCAAGCTGACATAAAGGATGTTGATTATTCAACCTTAGATTATTTGAATTAACCAGAAAGACCATTTGTTCCTCTTGAATCTAAAAATAAAGGAAAACATGTCTCTAAAAGTAACTAATACTACACAGTTGCAGATATTAATGAATATGCAATAAAACCACATCCTTGGGATCAGAAGGTTAATGATATATTAGCTAACGTCTATGGCTATAAAAATTTTAGAAATAATTAAAGAGCAATTATAAATTGTGTCTTGGAGAATAAAGATGTGTTTGCAATGATGCCCACTGGAGGTGGCAAATCTCTTACATTTTAAATACCTGGACTTGTCTAAGATGGAGTTTATATTGTTATTATGCCTCTTATTTCACTTATTTCTGATTAATACAATCACATGCTTAGGCTCAATATTCCAGTTATCAGAGTTTAAGGAGCTAGGAAGAACTACTAAAGAGAATTAGATTCAATACTTTATTCAGATAAGAATTAGTCTAAAATTGTGTTAATCACACCAGAAAAAATATCATCAGATGAAGATTTTAACCAATTTTTAAGCTAAATTTATGAAAAAAATAAATTGAGAAGATTTGTTATTGATGAAGCTCACTGTGTTTCTTAATGGGGACACGAGTTTAGAAAAGATTATCTTTCTTTAGGATAGTTAAAAATAAAATATCCAAACATTCCTACACTTGCTCTAACTGCTACAGCTACTGAAAAGTGCAAAATAGATATTATTTAACTTCTTAATATGAAAGGAACTCTGTATTTTTAATCTTCTTTTAATCGTACAAATCTTTACTACGATGTAGTAAGGATACCCTAAAAAGTAACAATCGAGCATATGGTTAATTTTATCAAAGAAAAGTTTAATAAGCAAAGTGGTATTATATATTGCTGCACAAAAAAAGACTCAGAAGAATTAGCTAGTAAGCTAAATATATAATATAAAATTAATGCAGCATATTATCACGGATCTATGAATGACAAAGAAAAAGAATAAGTTCAATAACTTTGGATGTCAAATGATATTTAAGTAATATGTGCCACAATAGCTTTTGGTATGGGTATCGACAAGCATGATGTCAGATTTGTCATCCATTATACTTTTTCTAAATCTATCGAAAATTACTATTAAGAAGCAGGTAGAGCAGGAAGAGATGGTAAAATATCTCACTGCAGAATTTACTACTCTCCAAAAGATAAAAATTCTTTAGTCTTTTTGATCACTAATAATGAAGGCAGCAATAAATAGAAAAAAGAAGAATGCATGGCTCATTTAAGTAAAATGATAAGATATTGCGAAGATACAATTAATTGTAGAAGGGTTTTGCAATTAGCACACTTGGGTGAAAAATTTGAACCTAAATTTTGCAATAAAATGTGCGATAACTGCAGAAATTAAACTTCTAAAAGCAATATAATACAAAAAGATTTTACTTAAGATTGCAAAAATATACTATAAGAATATTTGAGTATGTATAATAAAAACATACAGCTGACTTAAAAGCAATTAGTAGACGTTCTCAGAGGTAAAAAACTACAAAAAAAGGCAGGTTAAAACCTACTTAAAATGATTGAAAACAGCTCAATCTATAGTCTATTAAAGAATTATGATTAATTAACTGTTGAAAATATTGTTAAAGAAATGATGTCTTAGGGTTATTTGAGTGAAAAAATTAAAAAGTTTCGTGCTTATACTTAAGTATTTCTTGAAGTAGTTAAGTCTAAGTATAATGAGTTATGTAATCCAAACAAAATGACTGACAAAATCATGATCAATTAAGTAGTTTCTCAAAGCTCTAAATCAAAAGTAGATAGTCAATTTTTATTTGACAAAGAATTAATTGATGATATTACAGAATCAGATTTACCTAAAGAGTAAGAATTTTTTGATTAAAATAAAAATCTCATTTTTGATGATGAAGAATCACTATCTTAAATGTCTGAAGGTGATTTAATAGATTTAATTGATCTTGCAAATAAGAATAAAACTTCTTGCAACCAAAATGATTCGTCAGATAACATGTAAGAACTAAATAAATAGTATAGCGAAGATGATTCAGACTTTTAATTTTAAATACCTTCTGAGAGAAACTAATAAAGTAGAAGTGGGATTATTTATGAAGAAAATGATGAATAAAATTAAATTGGTCAAGCATATAGTGAGGATTATAACAGTCAAAATAAATAAGCTAATGAAAAACTAAACTAAGAACAGATATAAATTGAAGAGGATGATGATGACGATGATGACGACGATGATGATATTTTACAAATAGCAGCTAAAACAAATCTTTTAGAATAAATAAAAAAATAAAACACGATGAGTGTAGAAAAATAAAATAGTTTGAAAGAAAATTATCTTTATAAATCTCCTCAAGAATAAGATAATTTCTTTTCTGAATTTAAATTAGGCAATAATAACAATAAACCTTAAACTTCTTTAGGATAAACAGGTCATAAGCCACCTTAATAAAACAATTAAAATATGAGCTCATTGAATAATTTTAAATTTTCTACAGGAAACAATAAATTAAAATAAGACTAAGCTGATCTTTTTTCATTTAACTTTCAAAAACTTGCAAAAAATTGAGTTCAATTAATAAATAAATGTAATTAATAAAATATAAATTAAAAAAATAAATAATGTAAAAAATAAACATCAAATAAATTAATTATTAGAACTAAAAAAAAATGTGTTAACTTTCAATCAAAATTTATCTATTAAAATATATCCAACAATAACAACAACTATATAATATGCTTTCTCAATTAAGTAAATAAATATTTATAACATTTTTTCGCTCAAATATTTGTTTTAACGATTTTTGTGTAATTTTATGTTAATATTAAATTATCTTAAACTGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1337.7 L-2256.2 L-3261.1 S-0311.1 S-3328.9
S-6219.8 S-9299.5 S-12266.1 S-15235.4 S-24314.6
C-0318.8 C-212,391.5 C-45,355.4 C-63,263.0 C-81,596.0
C-101,111.1 C-122,268.3 C-141,978.0 C-16957.9 C-18708.7