Summary
Transcript IDgene_000001675
Gene IDTTHERM_00245200
Length1891 bp
Sequence
AAAACATCAAAATTAGTTTAATTAATTAGACAATACCAAAAGCAGATCTCTCACAAAAATTTAGAAATTAGAAATTTAAGAATAATAATTAGTTTTAAATAAATAAAATGAATCAAGGTTTTGATTATTTAATAGTATTAACATCAGGTTAAACAAAAGAATTGGAGAGAAACAATTAGGAGGAATAGAAATAGAGCACAAGCAACAATCTTTAAAATTAACTCCAAGAAGATAATGATTCTACTGAGTAGCTTGGAAGGATGATAGAGTTTAATTGGTGCATTTACGATACTAAAAAGTAAATCGTCACTGAATAGTTCTAAAGATTCATCAAGGGAGAAGATTTCTTAGTTAATAATGAGACTCTTACCAAAAATAAAATCACTCTTAGCAAGTTCGATGGTGCATTGCTATTTAGCAAGCTTATTTAGGAGTTTAATGATTACACATATACTAATTTCACACGCTAAAACAAGAGTTTCTGCATAGTCACTTACGGAGATGCTCTCATGACTAGAATCTTACCCAGAGAAGCTTAATTTAATCAAATGAAACTTGCTTCCCACTTTTTCACTTATTTTGACATAAGAAATGAATTCAAAAAGAATTTCTCTCATGCCATATCTATCAAAACACTACATGAAATGTTAACATACACTAATCTCCAAGAAAAACCACTTTTAGACTAATCTATAGGGTAATTTGAAATGAGCAACATAGTAAGATTAGTAAATATGCTTGTAAGAAGCGGATATGTCTTCAATCATCCTAAATTGATCAATAACTCTTATCAAGTTGTGTTAGACAATTAGGACTCTAAGACTAGATATATTCAATCAAGAGAAAAGAAGTCAAAAAATAATTATGTCAGAGGCAGAAGCCCTGAACCATTTAAAAACCTTTCACAATAACATTTTATTCGCATAAGAGGCCTTCCTTACTCTGCAAGAGAACCTGAAATCTACGAATTACTTAAAAATATTAGGATTTATAAAGAGGATATTGCTTTTCTTTATGATAGCGAAGGTAAATTCTCTGGAGAAGCATATGTAAGAGTTTACAGCTAGCTAGATAAACAAGAAGCTTTGTGCTACAATTTAAATAAGGTTGAAGGAAGATTTGTTGAGATTTTCGAAACTACAGAAAATGAATTTAATAGAGCTAAAATTTCTTAATTCCCAGAAAAGAGAAATCAAGATGATGAGCTACCAAATGAAACTCAATTTGATCTCAATAAAATAGTCACTGAAGGAGCAGGAGTAGTAAGAATTAGAGGCTTACCCTACTCTTGTACTGAAGAAGATATTAAAAAATTCTTTAAAGGATTAACTATTTTACAAGGAGGTATTAAGAGAGCTATTCTTGGTGGCAGACCTGGAGGAGAGTGTTTTGTAATATTTTAAAACAAGGATGATGCTCATAAAGCTCTTAATTTTCATATGGAAAAAATTCACAACAGATTTATAGAAGTTTTCTTAGCCACAGTTAAGGAATTCGAAAATTATATGGCACATAACTTTGTTAATTCTGCTCCTGTTTATAGTAAAGATAACATGCCAAATATTCCACAAGAGAAAAGAAAATCAACTCTCATGGTTATGGGAATGCCTTTCAGTGTAACTAAATAAAAGATTTTAGAGTTCTTCAAAGGATTTGACATCAATGAAAGAGAAATACATCTTCTTTGCTCTCATACTGGCAAATTTAGTGGATCAGCTCTCGTTACATTCGAAGACGAGCTTGAAGCCCAAAGAGCTCTAAAAACAAAGAATTTCTCATATATTGAAAATAGATATTTAGAATTATTTGAGTATAAATGAAAGAGTGAGTTAGTGTGAATTTATTTATTTATATAGTTAGTTATAAAGAAGAGTTTAATTCAAAATCTATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1842.3 L-2861.8 L-3730.9 S-0225.7 S-3550.5
S-6311.3 S-9416.6 S-12527.6 S-15667.2 S-24557.5
C-0245.8 C-21,638.1 C-44,205.6 C-63,885.6 C-82,256.5
C-101,849.6 C-121,478.8 C-141,238.7 C-16923.4 C-18743.4