Summary
Transcript IDgene_000001712
Gene IDTTHERM_00248520
Length2149 bp
Sequence
AAATTAAATGGGTTAAATTATTCATGGCTCCTACTAGAGCTAATAAATATAAGAATTTTGTGAATAGAATAGCATAGATATTAACATATTTTAGAATTAGATCAAGTTTTTAAGTTAAATGAAATATTAATATGTTGGAATATTAGGAAATGGATTATTTGGTTAGCAAATACAAGCATATTCTGAGAATTATTAGAGTGTAGCAATTAAAATAATTTATAGCAAGAACTCTGGTTTAGAAACAGCTCTTAAACAATCAACAAAATACAAATAAATAAAAAATACATAACATCTTGCGCAGATACATGAAATTGTATACAATCCTTCTTTAAACACTTATTACATTGTGTAAGAGTTGGCTGATTGCTCCCTTAAGGAAATTCTTGAAAGTTGCAAGCTAACAGATAAACAAATATATGAAACTACACTGCAACTGTTAGAAGGTTTAGCAGAACTTGAAAATTTAGGATTAATACATGGAGATATCAAGACAGAAAATATCTTATACAATAGACCTAAAAATAAATTTATGTTTACTGATTTTGGTTTGGCTCAAGTTTTAATGAAATCTAATAAACCTGCTTCATCTAATTCCAAACAACTATAAAGAACTTAAATTTATGGTGCTCCAGAACTAGAAAAAGAACAAGATACTTCAAGATTTTAAAATAAGATGGATACATATGCCCTTGGAATGGTTTTGTCTGAAATAATTATTGGAAAAGGATTTGAACTTGAGGAATCTATCGATATCAAAAATAATAATGACATACAAGACTACATACCATTCGACTCTCATCATAAATTTTACATAGAAAAGATTATTTTAAATATGGTGAAGGTATCGAAAAAAGAGAGATAAGAAACTAGTGAACTGATTAACACTCTTAAGAAAAATTTTGAGTTTAATGAATAAGATTTAATGGCTATTTATATAAAAGAAATATCAAAGCTTCTTTAAAACTAACAAAAAATTAGCAAAGACTATCAAATGTATTATCAGAAGTATTTTTCACAAAGAAACTTATAAAAAATAAGTGCTAACGAATCGAGAACATAAATAGGTGATGGATAGTTATATGGAATAATTGATGCCATCAAATTATGCAAGAATATTTAAGAGCTAGAATTACAATTTTATGTCAATTTAATAACAGATAGTGGATTATTTGCAATTACCAGCTTGGTTAATGATCATTCCAAGTCTTTAGAGATATTAACTATCAATTTTGAAGAAAACTAAATTAGAGATAGAGGCATTCTACAATTATTTCAGTCTATAAATAAGTGTTTGCTGCTGAGAAAACTTTCTCTTAGTTTCACAAAAAATAGAATTACAGATGATGGTTTTAGAGGTCTTATTCCACTAGCTAATTCGAGTTAAATTTAATTGCAAGAATTAAAGCTACATTTCTCTGAAAATTAAATCACAGGAAATGGGCTAATAGATGTATTAAAGGCTCTTTAATAGCAAAAGAAACTTACAAGTCTTTCTCTGTATTTAGCAGATATTTGTATCAACGATCAAGATTTCTACGGTATTACAGAAGTGTTAACCAATTTTAAGTAATTGCATGAACTCAAATTATGCTTTTAGAGAAACGATTTAAGTAGTGATGGGTTTAAAGGATTGGCAGAAATATTTAAAGATAATATTTTATTATAATCATTAGAATTTTACTTTTAGTAAAATAAAATAGATGACTAAGGACTAATCTCTGTTGTAGATAAATTATAATTCTGTTAAAAGCTATAATTAGTAGAGCTATTTTTTTCAGAAAACCGAATTACCGACCATGGGCTTATAGGCACAGCAGATTCTCTTAGAAAATGCAAACAATTAAAGGACATTTATATAGATTTTAGTGAAAACAAAATTTAAGAAAAGCAAAGGATTTAGTAAATATTCGATGGTAATTTTAAAGGCAAAATGAATTTCTATAGCATAGATTTTTGAGTAGTTTAGAGATATTTTTATGGATATTTTAATTATTTATTATCAAAAATAAATTTCTATCATAAATTAAATGGAATACGAATAATTTAAATTAAGTTAAAGATAAAAACAAATAAATAAATAATTATTATTTTGTCAACTCTAAAATTTGTTTTATATTTATCTGTTAATAAGTCTCAATTACAATAATTG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1448.2 L-2422.2 L-3412.2 S-0302.8 S-3350.7
S-6400.1 S-9347.3 S-12425.4 S-15383.1 S-24458.3
C-0286.5 C-2821.3 C-4429.8 C-6522.4 C-8263.6
C-10686.1 C-12572.9 C-14428.9 C-16375.7 C-18425.9