Summary
Transcript IDgene_000001863
Gene IDTTHERM_00257160TTHERM_00257170
Length2426 bp
Sequence
AAAAAAAAGTAAAGTATAAAGAAACATATAGTTAAAATGTGCGCTTCTTATGCAAGATAACATCAGAAAAAACTATAGTTTGTACAAAATTAGTTTAGCAGCGTTGGAGGAAATACAAGATAGAGGTTGTCAAGTGAAGAAAGAAGACATTTATTGAGTGATAAGGATGCATATATTGAATACTTAGAAACCCAATTAGATAAAGTTTGCGAGCTTTCCTTAGTTGAGAATCCGCAAATTTAGAAAAGAGTGTAGGAACTTGAATAGTCAATAACTGACCACGAAGAGAAATTTGCAAATATTACAAAACTTATAAAATTACTATAAACTTTTGCTGAAAATTAGGAAGATGAAAATAAGTTAATTAAAGAGCACTTCAATAAGCCTTTAAATAGCTTTGGGAAAAAAATAGAAAACTTTCAAAATGATTTGGTTAGCGAACTGAAGGATTAAATTATAAAGATTGAAGAAAAGGATGGCCAGAGGGAGTCTTAGATTTATGAGACTTTATCAGCATTTTAGAAGAATATTAACGATTTTGAAGTTAGAATTGAATAGTTTGCCAACTAGCTTTCAAAAGACATGGCAACAGATATAAAAATGTTAGCTACTCAAATCCAAGGTGAAGCAAACAGCTAAAACACAGCATCAATTTAACCAGATTAGCTTAGAAATTTTCCAATTGTATCTGACAATCAAGTCAAATAGAATTTAGATAAATTCAGAGAAGAAATCAATAAAAAAATTGAATTTGTTTTAAAGGAAATGAGAAAGAATGCTCTTTTAACTGATGTTGAGTGTGTAGAAACTAAATTAAAAAAAGAATAAAAAGAAAGAACTTATTTATGCAAGTTTGTAGAAGACCTTACCAGAAAAATAGACGAATTACCTCAATCCATTACAACCCGTGCTAGCACTTCAAGAAATGTCTCCCCTTCAGCAGTTTAAGAATCAAATTAATTTAAATTAGTTAAGTAAATTGAAAGTGATATTGAGGATTTAAAAGAAGTAGTAAATGCTTTAGTCGATAAGATTGAAGAATAAGATAAGAAGAAAAAGTCTTCATTTATAACAAAAGACTAATTTGATAGCTTAGAGAAAAATTTGACATTACAAATCTCAAGATTTGTTGATCGTTTTTAGAACTTTTAAGCAAACCCTTCATAAAATGTTGCTTATGATGAATCTTTAAGGGAATCTGATAATTAAAGAAGTAATAATAATTTCTCAGCACGACAATAATACTCTACATTAAAGAGTGATTAATATTTAACTTAATAAATGAGATCTCCTTAGTTTGAATAGCAAGGATGGTAGTAATAATAAATGTTACAGCAAAATTAGTATTAATTAAATAACCAAAGTGCAGAAATACACCCTGAAGACGACTCTTACATGATGCAATAAAAATATTCTCCAATAATTTAAGACGACCAAGACCTAAGGGATACTCTGATTTCTAAAAAAGATAAAAACACATCATTAAATAACTAATAGTCAGGTGGAGATAATAATTTAGGAGAAAGCTTTGGGTTAAATTAAAATAGTCATATTTCTAACAATCTTTCAGATAAATTAGATTAAAATAAAAATAAATCGAGAAAGAAATCTAGTAATTAAGAAGAGATTCTTGATTAATATCCATAGAGAGAGAAGAGAGGAGTGGCATCTTCTAGTTCTAAATCAATAACTAGATAATCAGATAAAGAAAATAAATAAAATTCTAATTCATAGAACAGAGGTAGAAAAGCTACCGACGAATCAGTCACTACACTTAAAAAGAATAAAAAAAGAGAATTAAAATCTGAGTCCAAATCTATGTCAAAAAGTCCTTCGAATATAGGAGAAGTTTCCAGCACTAAAAGCATTAATGCTTCAAGAAAATTATCCTAACAAAATATATCTATAGACAGATAATCTAAATCTAACACAAGAGTAACATTAACTGAACCTGAAGAAACTCGTATTAAATCGCCTCTATCTAATATATCAAAAAATAAAAGTGGGTTTGAGTCAAATCAAAAGTCCAAGATAAAAAATAAATCTCCTTCTCCTATAGGTAATACTAATAAATTCGCTGAGAAGAAGAGACAAAATGGAGAGAAAATAAAAGAGTTATTCAAAAAAAAGAAGTAGATGGATTAAAATAGCTCTTCTCATACTAATTAAAATCACTCAATATCTTAAAAATCAGCCAATATTTCAGTAAATGAAAAAAAATAAGGAGATAAAAAGAAGAAATGATTAAAATGATTTAATGAATAATTATCAAAAAATAATAATAATTTTAGCTATACAAAATAATAAAATTAACTAACTAACTAACCTGTTACAATATAGTTTGAGATAGAATTTATTTACCCCTTAAAGATTAAATATTGAACAAATATTACAAAAATAAAAATGAACACAAAAATATCCTACAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,590.1 L-21,261.0 L-31,405.1 S-01,241.7 S-31,053.8
S-6926.3 S-9993.7 S-121,244.7 S-151,138.7 S-241,436.8
C-01,097.7 C-22,959.7 C-41,281.2 C-62,101.6 C-82,210.9
C-102,304.0 C-122,297.5 C-141,901.8 C-161,548.5 C-181,654.2