Summary
Transcript IDgene_000001968
Gene IDTTHERM_01104910
Length2233 bp
Sequence
GAATAATATCATAAATAGTTAAATTATTTAAGTATTTATTCTAGAAAGGGAGAAAAAACACATATTAAAAAGTAGAAGCAAATACAAAGATGAGAACCTCAGCTAGATATTTTACAAACTTTTTGAAGAATAAAGCAACAAATAGTTTTAATGCTTTCAATAGATAACAATTCAGAAACAATTTCGCCAAGCAAGTTATTCTATTAACAGGTATCCATTTGACATGGAAATATGCTGCCTAAAACTTAAACTGCGAGGAAGAAGCTAAATCATAAGAAGAATTAGAAAAGGAATTAAAGCAAAAATTTGAAGAGGAAATGAGAAAGAAAAGAGTCGATTCCATGAAAAATTTACAAAGATATGAAGTATGCAACTCTGTAGATATTTAAGAAGGTTAGATATATCCTTTCTAAGTTAAGGATGGCGAAAATGGCACATTTGAAGTTGTTATTGTTAGATACAATGGAAAGTTATATTGTGTTGGAGGTGTTGATACTTATGACGGTAAAACTAAATTGAAGGATGGTATTTGTTTTGGAAATAAGCTTTATAGTCCCATGAATGGTTCTGCTTTTAATATTGAAAATGGACATCCTGAACTCGCTCCTGCTATTGATGAACTTCCTAGATTTTTCGTTGAAGAGAAAAATGGTAAAGTTATTCTTTATGCTCCTAAAATTGTACCTAAAAGATTGGTTCCTGCATTTGCCTCTAGAGATATTAACGACGTGAGAAAAGTTGTTGTTATTGGAGCTGGACCTGCTGCACTTGGTGCTATCGAATCTTTAAGATTGAATGGTTTTACTGGTGAAATCATTATGGTTACAAAAGGGACAAAGATGCCATATGATAAAACTAAGCTTACCAAATCTTTTAAGTACTTAAATTATGATAATCTAACTCTTCGTGACGAAGACTGGTTTGATTCTCATGGTGTTAATTATATGCTTGGTAGAGAAGTTACTTTTGTCGATAAAACACACAACAGCCCACATATTCTTTTAGAAGACGGCTTAAAATTAGAATATGATAGTTTAATTATAGCCACAGGAGTTAAACCTGAAGTTAGAAATATTAACGGTATCTAAGAAAAAGATAATGTTTCATTTTTATACAACATTGATCACCATAAAAAAGTTAAGTAATACCTAGAAAAAGCTAAAACAATTACAGTCCTTGGTAACAATATGAGAGCTATGGAATGTGTTTCTACTATTAGAAGAGAATATCCTCACATTAAAATTTATGTTATTGATGAAAACGAAGATCCTGTAATTAAAACTGAATTCGGAGAGGATATTTACAAAAAAATTTTAGATACTGCTTTAGATAACAAAGTTAAGTTCGTTATGAAAAATCCTGTTGATAAGATTATTGGTGATGATAACTTAGCCAAAAAAATATAATTCCGTTCAGGACTTTAAATTGAAACAGACTTTGTCCTATTAATGCCAAACAACTTTAAGGCTGATAATGATTTCTTATTAAATAATGATTTAGATTAATTTGAGTTTGACGATATTGGAAGAGTAAGATGTGATTATGATCTTAGAACTGACTATAAGCGTATGTTTGCTCCAGGCTCTGGTGGTGTTGCTACTTACTTTGCCGCTAATGATAGATATCCTCACATGTAATGGAATACAGCTTATCATTAAGGTATGACTGCTGGTTACAACACTCTTGCTTTGAACATTCCTTGGCATTAAATTCCTTTTGAATAATATGAAATATTTGGAAAGGTTTTACAACATATTGGTTATGCAAATGTTGAAAATGAAGTTTACATTTAAGGTGATGTTTAAAATTGGGATTTCGTCGCTTTCCATGCTTGGGAAGGTGAAATTTTAGCTGTTACAGGAACTCCTTCTTAAAAGAAAACAATTAACATTTTAAATGAAGCCATTAGATTAGAACTTATGCCTCATCTTATAGAGTTAAAGAAAGGATATAAAACTATTGAATAAATAGAAAAAGAAATCAGAGAATCAAAAAGAAGCACATGCTTTAAAAATTTAGTTTATGAATTAAGAGATAAGCCAAATCCTCATGATGTTATTTGGTTCCATAGAGAACGTCAAAGTAGATACTTCAATTTCTGGGAAGAAGGTGTCATGCCAGATCAAAACTACGCTCCTCCTACTCAAGATCCAGTAGTCTGAGTCTGTTTTATAATATAATAATAACCTTGTATAAATATTTATTTAGCATTTCAAATAAATTTTTATTTACC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-17,270.5 L-27,761.5 L-36,302.0 S-02,949.0 S-3131.5
S-684.4 S-998.0 S-12137.7 S-15223.2 S-24244.4
C-065.8 C-2110.3 C-4105.8 C-6109.7 C-8501.6
C-101,122.8 C-121,022.3 C-14358.4 C-16230.9 C-18188.7