Summary
Transcript IDgene_000001969
Gene IDTTHERM_01104920
Length1580 bp
Sequence
AAAAAAAGAAGGTTTATATTTTTGCAAATATCCTTTTTGAAATAATTGAAAGATTTCAACAAAAGATTAAAATCTGAAGAATTAGAAAAGCATAATCTAAAATCAAAGTATTATAATAAGTTATTTGATAAGGAATGACAACAGCATAGAAAATAGCTGAAGTTGAGCTAGAAATGGAACGTACCCAAAAGAATAAGGCTACTTCCTATCACTTGGGTCAATTAAAAGCAAAATTAGCAAAATTAAAAAGAGAATTGATTGAAGGTGGTAAAGGTAAATCAGGTCCTGTAGGAGAAGGTTTCGATGTCTCAAAGAGTGGTGATGCTCGTGTTGGTATGATCGGTTTCCCCTCTGTCGGTAAATCTACCCTTTTAACAAAGCTAACTGGTACTGAATCCAAGATTGCTGCTTATGAATTCACAACATTAACTTGTATTCCAGGTAATGTCTTCTACAAGGGATCTAAAATTTAATTGCTCGATTTACCTGGTATTATCGAAGGTGCCAAGGATGGTAAAGGTCGTGGTAAATAGGTCATTGCTGTTGCCAGAACTTGTAATTTGATTTGCATAGTTTTAGACGCAACAAAGCCTATGAAACATAAAAAGATTATTGAAGGTGAATTGGAAGGTTTCGGTATTAGATTAAACAAACAACCTCCTAAAGTTGATTTCAAAATTAAGCCAAAAGGTGGTATTAATATTACTCACATGGTTGAAAATCCTGACCTTGATGATGAAATGATTAAGACCATTTTAAAGGAATATAGAATTAACTCTGTCGATATTGTTTTTAGAGAAAAGATTAATGAAGATTAATTAATTGATATTATTGAAGGTAATAGAAAATATATTCCATGCCTTTATGTTATGAATAAAATTGATGACCTTACAATGGAAGAATTAGATATTATTGACTAAATTCCTCATTATGTTCCCATCTCTGCTCACTTGGAATGGAACCTTGATGAATTAATAGAACGTATGTGGGAATACTTAGATCTCTATCGTGTATACACTAAACCTAAGGGCAAAGCTCCTGATTATGAAAAGCCTGTTATCTTGCCCAGAAAGAAATCTACAGTTGAAGATTTTTGTATGAGAATTCATAGAACTATGATTAATGATATGAAATATGCATTAGTTTGGGGTACTTCTGTCAAGCACAATCCTCAAGTATGTGGTAAAGACCATCAACTTAATGATGAAGATATCGTTCAAATTATCAAAAAGATTTGAGCAATTTTATATAAAATAATCAAATTTAATTTGCAAGGAGTAAATTTTAAAATATTTTAAGAGAAAAATGACAAGTAAAAACCATGAATAGAATCAAATATTTAAGCTTCATTCTCTGATTAATTATTTTAAATGCATTTCTTTCTATTAAAGCAAATTAAATCTATAAAGAAGGTTTTTTAGTAGAAGTAATTAAAAAACTAATTATGGTAGCGACTACTTACTTTTATTTAATTGATAAATATTTAGAAAAATATATATAATATTATATTTAAATTGTTATGTGCTTAATTTTAGTTAAAAGTTTCTTACATGTATTTTTGACATAAATTCAACTAATTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-111,791.6 L-29,875.8 L-37,410.7 S-05,689.6 S-35,734.2
S-65,815.4 S-96,938.1 S-127,337.0 S-157,813.2 S-247,734.7
C-06,098.6 C-211,105.0 C-414,431.9 C-613,655.9 C-810,456.2
C-106,781.6 C-126,064.2 C-144,772.9 C-164,331.2 C-183,768.9