Summary
Transcript IDgene_000002067
Gene IDTTHERM_01166280TTHERM_01166290
Length3456 bp
Sequence
CACTACAAGGAATAGTTTTGTATATTCGTAAACAAGCAAGATAGCAAGCAAACAAGCATAGAAGAATATAAAAGGAATTAAGCTTGATTGATCGATAGGCTAACCAATAGGAAGAAGCATACAAAATAGTGGACTATATTGGAAATTAAATAGATAAATTTTATAATTTGGATGTCGCACAAAGTGAGAGACTAAGAAGAATCTAACAGATAAACAATATATCTTAATGATCGTACATAAAATCAATTGATTCATAGAAAGTTTTACAATCATATAAAGACATCAAAATACACATGGTGGAACTTTGTTCCAAAGGCGTTGATTTTGCAATTTATGAGAGCAGCTAATTTTTATTTCTTAATTTCTACTGTTGTCCAATGTATAGATATCATTTCCCCTTTAGCGCCTTTTTCCGCGGTTGGCCCACTCATATTAGTGCTTGCCGTATCTTTATCAAGAGAAGCAATTGAAGATTATAAAAGACACCGCAATGACGATCTTGTCAACGAATAGAAATCATTTATTTTTAATAACAAAAACTTTACAAGCATTATGTGGAAGGATATTTAGCTTGGCGATATTATAAAAGTTAACTAAGAGCAGATATTGCCAGCAGATATTTTGGTTATTACAACAAATGAAGAAAACGGCACAGGTTTTGTCGAAACTGCTAACTTGGATGGTGAGAGAAACCTAAAAAGCAAAATATCTCATGAGATTGTAAACAAGTACGGTAGAGAACATTCTCTCATTAAATTCAAGGGAAAAATTGTTTGTGATAAACCTAACAACAGAATCCATAGTTTCAAAGGTTTGCTCTATTTGGACGACGAATCGAAACCAATAGTACTCAACAATAATAATGTCATGCTCAGAGGCACAACTTTAAAGAATACTGAATGGGTGATAGGAGTGGTAATTTATTCAGGTCAAGACACGAAAATAATGAGGAACTAAGGGCAAGTGAAGCACAAATCTACTCATATAGAAAAGAAAGTGAATCCTATAATTTTTATAACATTGTTAGTTCAATTAGCTCTATGCATTATTATGGCTATTCTTCTATCTATTTTTTAGAAAAACACAAATCCTTTGGAAAATAATAAATATAACTACGCTTATCTTTATGGAAACAGTAGCGATGGTCTTTATAGCTATGAAGTTTAGGGAACAATCAATTTTTTTTCATACTTTTTACTATTAAATTCACTTATTCCTATTTCTTTGATTATTTCTATGGAAGTTGTCAAACTATTTTAATCATCTTTCATGGAGTATGATGCTGAAATGCACTATTTAGACGATGGATAAGTTCAAAAAATGAAGGTGCTCAATACTATGATTCATGAAGAGTTAGGAAAAATTGATTACATCTTTACAGATAAAACAGGAACATTGACTTGCAACATTATGATTTTCAGACATGCAAATATCGCTGGTTCTGACTACTCTGAAAAAGAACTTGAAGACATCTTAGCAAAATTAGAGTATCAAACTCTCACTTACGATGAAGAATACAAAGATTTTTATCAATTTTGGATGTGCATTGCTATTTGTCACGACGTTATCCTTGAGGAAAAACAAAACGAAATTAATTATTAAGGTTCATCACCAGATGAAGTATGTCTCGTAGAAAAAGCTCAAAAATATAATTTCAAATTTCTCAAAAGAACAACAAATTAAATATTTATACAAGTGGGATCAGAAATGCATACATTTAAGCTTCTCAATAAAATAGAATTCACAAGTGAGCGTAAAAGAATGAGTGTCATTATTTAGGATCCAATAACAGGAAAAATATATATGTACACTAAGGGAGCTGATTCGTTCATGCTCAAACATATTTCGAATACAAGTGAAGCACTTAAAAGTAATATAAAGCAAAGCCTCAAATACTATTCAAAGCACGGGTTAAGAACTCTCTGCTTGGGTATGAAAGAGTTAAATCAATAAGAATATGATGCATGGAATTCGCAAATACAGGATTTAAATATGAACATGATTGGAGACTTGTTCCCTGAAAAAACTAAAGATAAAATTGCTGATCTTGAAAATGAGATAGAAACAGGCTTTGATCTTTTGGGAGTTACTGCACTTGAAGATAAATTGCAAGAAGGAGTTCCTGAAGTTTTAAAGGATTTCCATGAAGCTGGAATCAATGTTTGGATGCTCACAGGTGACAAACTTGAAACAGCAGAAAATATTGGTTATCTTTGCAACTTGCTGAACAATCAAACTAAAGTGTTCAGAGTTCAATCTCACTATCCAGACGTTACGAGAGACAAGTTCTTTAGAATAAAGGGAAGAATCAACCAAATAAAAACTGTCAGCGAAATAGGAGAAATAAGAATAAAAAACAACTAAAATAACCACCATGATTTCAAAAACAAAAAAGTTGGACATTAAAACCAGAATATAAACAGAATAATAAACGATGGAGGTTCCTAATCGAGACGAGATTCCTATCTAACTAAAGAAGAAAATAATTCATTTGAAATAAACTAAGTGAAAGGCTACACAGGATTTGCCTTGGTAATAGAAGGAGAAGCAATCGGTCATGCCTTACATGATGATTAATGTAGAAAAGAGTTCTTGCAAATCATTCCAGAATGCTGCACTGTTATATGCTGCAGATCAACTCCAACATAAAAAGCAGAAATGGTCAAATTCGTTAAAACTCATTTTAATAAAACTTGTCTAGCTGTCGGAGATGGAGGTAATGACGTAACCATGATCTAAGAAGCAGATATCGGAGTTGGTATTATTGGTAAGGAAGGAAATCAAGCAGCTTTAAGCAGCGATTATTACTTTGGGTAGTTTAGGTTTTTGTGGAGACTTTTGTTTGTTCATGGGAGATGGAATTTATACAGAACATCTTACTTTGTTAACTATTTCTTCCTTAAAAATTTTATTTTCACACTTCAATAGTTCTACTTTGGGTTCTTTTGTGCTTATTCAGGGTAGTCTTTTTGGGAAGACGGTTATTTACTCAATTTCAACTCTATTATTACTGCTTGTGCTCCAGTTTATTTTGCAGGGTTTGAGTAAGATGTCAATCCTCATGGATCTGAGTACATCGCTAAGTATTTGCCTCGTCTCTACAAAATATTTAGAGAAAAAGATCTTTTTTCTTTTAAGGTCTTCGGAATAGTTTTCTTATAAGGTGTTGGCCTTTCTCTTACAACTTATTTTTCTGTATTTTTTATCAACTATTAGGATTACTATTAGATGAGCGGAGATGGTAAAATCGATGGTTTGTGGTTTTAAAGCTTTTCTTCTTACTGCAGCACAGTTGGAGTGGTTTGGGCTATCAATTTTATGGACACAACATATTTTTCACCATTTACTTTCTTTTCTTACGTGATTGTTAGTTTGTTCTTATTCTTCCCTGCTTTCGCTTTTACTTATGACATTTTTGCTGGTCCCTTGCAAGAAATGTTACTTATAAACATTGGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1233.7 L-2171.7 L-3158.1 S-0170.2 S-3142.7
S-6130.0 S-9112.6 S-12260.4 S-15183.5 S-24203.3
C-0152.8 C-2267.5 C-4300.4 C-6272.5 C-8122.8
C-10214.7 C-12123.9 C-14123.8 C-16100.7 C-18108.1