Summary
Transcript IDgene_000002068
Gene IDTTHERM_01166300TTHERM_01166310
Length1051 bp
Sequence
ACTTAGAATAACTATTCAATAGAACCAGTTGTTTCTTTTTAGAGTGATTTTTATATTAAGATTTTCTTCAGAGTTCACCACAACGGAGTCGAATCTCAAAAAGCCCTTGAGAAGTTGAGCTTGGTTTACTAATGCAGTGAGTGCCCTAATTATCACGTTCATACAATAGCCAAAGTTTAATAAAATACTATTGAAAATGTTTAAAACGGAACCTTGAAGCTCGAGTCTTCAATGGACTTAAAATTGAATGAACTAAAAGTTCCAAGCAATTGCAATGTTTGCGAATCTAGCTGGATTCTGAATGGTCCTCTATGGAATTAGCCATTGCATAATTACAAATTTGTATAGAATGTGCTTAGAAATTTGTAATCAACTGGAAGCGAAAAGGTGTTTAGCAAAAATAAAATTATGCTCATTCAGTCTCATTTAAAGTTGACAGCTTATTTAGAAGCAATTCTTTAAGAGAAAGAATTCGACAAGTTTATTTTAGGCTACAATTTGACTTTGATCAATGGCTTCTATAAAGCAAAAACTTATCCTACCACAAATCACATTAAGAGAGCTTTGGCTAGAGCTGGATATACAATTAATAGATCAATTTTTGAGAAAAAGATTTACAAAACTAACGCCCCTTCTAATGTAATATTTGATACAATGAGAGGATGGAAATGGGTGAGTGATAAATTTAAAGAAGGTCAAAGCATGTATCCAAATTAAAATTAAACCAATTAAAAGCAGCCAGAATAAGAAGACTAGAACAGTCCCTATTCTAGAGCTATGCGCAAACAATAACAATTTTACCCTAAATTCTCCAAACTTAATCACCTCGAAATCGAAAATATAAAAAATAATAACATCGACATGGATTACTTTTAAAAACCATAAAAAACTGTGTTCTATCCCAACCCTACTGAAAATTGGGGACCAAAGAAACCCTTTTCTATTGCTTACACTCACAAATTCGAAAAGTAAAAAATAAAAGATGAAAATTTAGATGACAACTAGATTTTTACTTAGAATGAAAATGACTCAAATGATAATAGTAGCGGAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1764.8 L-2581.5 L-3361.5 S-074.3 S-331.9
S-638.6 S-937.0 S-1237.4 S-1546.2 S-2462.1
C-097.1 C-242.0 C-440.7 C-649.5 C-862.2
C-10138.2 C-1273.8 C-1472.8 C-1654.4 C-1836.8