Summary
Transcript IDgene_000002215
Gene IDTTHERM_01246690
Length1482 bp
Sequence
GAATAAAATTAGCTAAAATCTTGTAGGATACCAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCTAAAAAGGAAAAAAATCAAAGAGATGTACCGAATGAAAGATGTCTAAATGCTCGATAAGCCTGAGTTAGTCATTTCTGATATCTAAGAACCTAAGTTAAAGCCTTATTAAGCTTTAATTTATTAGTCTATGAAAATCGAATTAAGTAAAAAAGGCTACTCTGATTTTAGATTTTTAGGACAGGGAGTATAGGGATTAGTTTTGTTAGCAAAAGATTCGAAAACTAACATGAGGTATGCCATCAAAGGTGTTTAAGTTAGAGATCCTCAAGGTAATCTTGACGAAGATCTTAACAATCGAGTGAAACAAGAAGTAGAAATTCTCAAAAAATGTAGAGACTCTCCTTATGTAGTCAGTCTTATAGATTAATTTGAGGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCACCTAGATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATATCAGCAATCAAATACGCTAATGACATTGCTCAAGGTCTCTACTACATTCACTCTAAGAGCTGCCTTGTTAATGATCTGAAAATGGATAATATCTTAATTGACTATCATGGAAATGCAGTTGTTTCTGATTTTGGTTTGGCAGATAACCTAATAAATAAATCTGGCTATGCTATGAATCAATATATGGGAAACTTCTTGTATCAAGCACCAGAGTGTTTTGACCCAGCTGATCCATTCATAGGTAAGGTTTATCATGATGAATATTTAAAATTAGGAGTCAGTGTGAGACAATAGCCAAGTAACAGAAGTGAAGCATGCTCTTTAGGGTATCTTATATATACACTTGTCTAGGGAATAGATTTGAGTTTTACATAAAATAAGCACAAACCATTAAATTATGATGGTGAATTTAAAAATTTTGTTTATCACAAATAGCTTAAATATATTATTGATGGATTAACTAATTTTGTTCCAAAGAATAGAATGCCTATTAAGGAGGCTTTAATTATTTTAAAGGGAATTATTTCTTTTGAATTTTAGTTAGATGAAATGCTTATTGAGACGATAGATGGAAACACTCAGCAGTTCACATGTTCATTCAAAAATGAAATTGAGTTTGTTAAAGATTTGTCAAATAAGTTTTACCCAATCATTAAAAACGAACAGACCTTAAACTAAGAGTTAAAAGAAGACCGTGAAAAAAGATAATATGAGGCAAAAATAGAAGAATTATAGAAAACAAATCTCTAACAATAATAAAGAATTAATGAATAAGAAAAAACCATTAAAGATTTATTCACCAAATTAGAATATTATTAGAATTAGTTAATGAACCAACCTTAGACTATGACGATGCCAACCTTGAAAATGAAGGACTAGTAACATGTTATATTTTAAGAAATTAAAAAATAGGAAAAGAAAGATGAATTTCCAAAAGAAAAAAACTAACT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,543.6 L-23,664.9 L-36,611.5 S-05,611.5 S-38,813.0
S-610,126.9 S-98,778.5 S-1211,118.9 S-1511,593.3 S-248,250.2
C-09,296.2 C-23,021.3 C-43,064.7 C-62,396.6 C-83,934.0
C-106,244.8 C-126,195.8 C-149,388.5 C-169,980.5 C-187,878.8