Summary
Transcript IDgene_000002235
Gene IDTTHERM_01251250TTHERM_01251260
Length4042 bp
Sequence
AAAAAAAACAATTAAAGCAATAAGTAATCTGGCATTCAAAATTTGATAACAAAGAGAGAGCAAAGCTTATAAATAAAACTAGGAAAAGCAAAAATATTTTATAAAAAAATCATTCTAAAAGGGTAGCAATAAGAAAGATAGTATGTATTATCCTGACTATCCCTACTATTAGAATTACTACTAGCTCTATAGTTATTTGCCTAAATATGGCTATAACACTGCATTCTCGCATTAGGCTGCTTCATCGCCTTAATGTCAAGTCGGTCTTGGAAAATAACAATAGCGCAAGTAGAAAGAAACTGCTGCACTGCAAGGCGGTAGCAGCAGTCAGGGTTAGCTTTAAAGCTCGTCAGGATCTTCAAGCGTTTACTCATAAAATTAATTGGGATTAGATAGATAAGAAAATAAAGAATCAGATTAGTAAAAGCAATTGATAGTACAGTGGTTAAAGTCCATGAACATAGACTAAAGATTTGAAGTATTTATGATCAAAGATAAATGGTTTGCTCAAACAATTACAAAAATGTATTGGAAGTAAAAGACAGGAGAATTTTCAGCTTTTGCACTGTATTCTGAGGAAGAAAAAAAAGACAGTAGAAATACCAACAAAATAGTAGAACTAGATTCTTAATTTTATTGCAGAAAATGTATTGACCATGATTCAGGTTCTAATGCACCAAGAAGAGAAGCCGAATAGGAAATTGTCAAGGTGCTAAGAATTATTGACGATAAAGAAATATACGACTCTCTCGTTTTTGATAAGGGATTTTTGGATAATATTGACCATTTGATAGATGTATTCGATATAGTTTCAGACAATAATATTTTTTAGACTAACCCCAACCAATACAGCTGGTTTCATCAAAATACATTTTAGACTATTGCTTGCTGGATTGTCAGTTAATTTGAGAGGATGGTTCAATTCAAATTCTATGAAGATAAACAGAGATATCATTAGAAATTAGGAAGATAGCCTTAGGGTTTGATCAGCTCTTCTTATTCTAACAACGCAAACAATCAAAGCAATAACTAAAGCAAAGAAAGCAACAGATCAGATGATAAATTTAATGATATTAATGCAGTAAAATTAAATGGTAGAAATTCTTCTACTGCTGAATCTTCTGGTTCAGATGCAGTAACTAACGGAAATTGTTCTTTATCTAAACAAGACTCAAACTCATACTCTTAAAACACAAATAATAGCAGCAATAATAACAATAATAATAGTAATCATACTAACATGACAAATTAGGGATACAACTCTTTCTCTTTAGATAGTCATTCAAGCCAAGAAAATTTGAGCCATTATTTAAGCCTTCTTTAATATTGGCGCAGTATGAATTCATCAAAAAAAAGAAAGATTTTAAATAAGGGATCAGAAATACATAAAACGCTCATTAGTTAAAGCCAAATTGAAGGATTAGATAAAAACGATAAGCAATTAGAGTGGTACAAAAAAACAAAGGACTAATTTTATCAAAAACAAAAACTCCCAAATGATGAAGAAATTCAATAAAACTTGTTGTAATTTCTTGATGACCAAAAGGCTGAAAAGTTCATTGATTAGTTGTGTTTCACTAGCTTAGACGACACTACTAATGTAATTACTATAATTTTAAAGAAATTGCATGAAAAACTGAACGATATGTACTCTGATCAAATTGCTTAGTATTTGATCCATAATGATGAGTTAGAAAAAAGTGTGAAAAAGAAAAAAAATAATACTTAAAATTAAGGCAGTTAAAATGGCGCAAAGAAAAAGAAAAAAAGCGTTAAAGCTAAATCTAAAGGTAATTCTGGTGGAAATAATGGGACTAATTCTAGCAGTTAGCCTCCTATTAAAGAAACCACTTTTGCAGAAGAAGTAAGTTTGATGCATTAGCAAGAAATCCTTCAAGATTAACAAGATAAATTAATTTAATAATAATAGTAGTAGTAATAATTGTAATAAACTTAAAATGAATAATAGTAGAAATAGGTAAAATAAACTGAAAAAATTGATAGCAAAAATTAAGCTGAAAGCTAAAAGCAAGATAATTAAAATGAAAATGAAGAAAAATCTTCTTCATTGGAGAATTCCAAAAAATGCGATAGCTAGCAAGGTAGTACTAAATTAGGATAATAGCAAATTAGCAAAAAAAAAGTAGCTGTTTCAAGCATGCCTTTAGTCTTGAAGATGCAACAATAATAAAAGAAAAATGAGTACTTAGAAGTTTGCTGCTAATAAAATAAATGCGAAATGATAGACATGACTAAATAGATAGCTTAGAGACTTATTTCTAGCTGCATTTAAATTGTTGATACATTTTCATAAAGAAGCGAAAATATGGATTCAAATTAAGAACTTCTGCTCTTAAATAAGGAATATGAAACAGATAATTAGTCATCAGGAAATACTAACAACACCAATTTAATTGTAAATGCAAGCATAAATGGTAATGCAGGCTCAACTGCAGGTTCTAAAAAGAAAAAGAAATCTAAGAACTAAAATATATCTTAATAGAACAATAATACTACTAGCATAACTTCAAGCTAGAACTTAAAACAAAAATCATCTAAGAGCAAATAAGATATTTTGGCAGAAAAAGATGAAGGCAAGATTTACTAAGAAAATGAAGATAAATAGTTAAAGAATAATGCTGATGGAGAAGATACAGAAGAACTTCCTCACCAGAATTACTCTGACTCAGATTAAGATGGAGCCAAAAAGGGAAGTGAAATCCATTCTGATAACACAACTATTGACTGCCAATATAGAATGTGCAGTGCAATAACTATTTCCTCAAGCTCCAAGAGAAAACAAAGTGATTCTCATCAAAGCAATTCTTCATCTCGACACACAACTAAAAATATAAATCATTTCTCAGACGAAGATGACTTCAAGCACTTTAACGATTAAATTAACTAAGTTAACAATAAGAAAACCAACTCATAAAACAACAGCAATGCCAAATAATAAAGCAAACAGAACTAAAATGATAAAAAGAATCAAAATATGTAATAAAGTAATTAATAAAATAAAAATCTTAGGCAAGGCAATCATAAATTGTAAGACAGAAAGTAACAGTAAAACTAACAAGATTCTGTACTGGAAAAAGATGCTTATTCTCTCACTATTAACCAAAATAACAATGTTATATGCAATAGTAGCATGGAAAGAGAAAGCATAGTAAGCAGTAGGAGTAGCTCTTAAATTTAAGTTTCTAGTTAAATGTCTCTTAATCATTAGAACTCAATGAATCATAACAACAATAGTTAATATACTACAACCGCTCAAGATGATTCTGACTTCATTCAAGTAAGTAGCAGAAAGAAAAATAATAAAAATCAGCAATAAGGATAAATTAATAATAGCAGTAATAATAACAACAATAGAAAAAATTAGAATAACTCTAGTGTATCAAATTCAAACAACAGCAATATTAATAATAATTACAATAGTGTATCTAATTCTAACAGATAAAATGGAAGAAAAAATAATAACAACAATACTAGCAATAATAATAATAATACAAATAGCAATAATAAAAACCAAAATAGAAGAAATAATAGAAATGATAAGCAAATTCAAGGGGATGGTAGATAAAATAATCATTAGCTTAGAAACAACAGAAGCAATGACGATTAATAAGTCTAGTTAACAAAAGAAAACAGCATAGTTTCTGAATAAAGCCAGCAATAAATAAATGAAGAAGAATTAAGTAACTCGACTAGCACCCAAAGTAGATTTACTTAGAAGTCAAATAACTAATAAAAAGAGGAAGCTATTGTTTCTTCTGACCTTACAACAAATAACACTAATAAATAAACTAATTAGCACTCCAAACATATATAACAACATAAAAAACCATTAAAAATATTATAAAAGTAAATTGCAATAAATACAATAGATATTCTCACATCAAAAGAAGAAGAAAGTCCAGAACTCAAATATATTCAGCTTTAATAGCAGCAAAATTCATCATAAATATCACCAAGCTTAAACTTGCAATCTCAAACAAGCAAGGATATCTCTTAATCAATTAAATAAACTGAATTTGAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,074.0 L-21,172.6 L-31,150.6 S-0274.9 S-3184.7
S-695.6 S-9120.4 S-1269.9 S-1560.1 S-2475.5
C-061.9 C-267.7 C-457.0 C-639.6 C-861.0
C-10137.2 C-1290.8 C-14129.2 C-16102.6 C-1886.9