Summary
Transcript IDgene_000002316
Gene IDTTHERM_01298450
Length749 bp
Sequence
ATCTCAAAAAATATAATAAATCTAATTTTTAGATAACAAAAAAATGTCAAAGTCTCTTTGGTCATAAATGGGAGTTAATCCCAAGACTTCATTTTATTACTCTAATGGAACAGGTAGAGATTCATATATTATGCATGATAATGGTGGAACTGTGAAAGCCAAATCAAATTATGGATATCCTCAACCTAGTAGATATATAAAGACCTCTAACGGACCAAGATCTTATAAACCATAATCGGATAATAAAGTCGTTCATTACATCTCCGATGGATCAGGAAGAGATAACTATATCCTTGTTAATTCAGGAGGTTTAACAAATTATACATACAGCTCAAATTTAAAATTCTTAAGAGGACTGAGAGAAGATACAACTCCTTAGTTTGATCAAATCCAAAAAGCTAAACTATACAATCCCGACTTGAATCGTCGACAAAGACTTTGGTCAGCATAAAATAGTAGACCTAAAAGAATAAGTGTTCCATTTGAATAGTAATTAGAAGAAGTTACTAGAAAAAGATTATCTACCCTTCAATCATTAAACAATTTTTGAAGTGATGCTATGATATATTTAACTAAAATCCTGTTTGCTTGTTCAAATAAAACTAATTCTTACTAATTAAGAGCTGTTGAATAAAAAGCTATATAAATCCAAAAATTTTACATAATACTTTAAATTAATTATTAGTAAATATTTATAAATATATTTTGTAATATTCATTATCTAGAAGGAAAAAATCCATCATATCATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,074.6 L-22,026.6 L-32,512.7 S-02,405.0 S-31,596.2
S-61,844.3 S-91,462.1 S-12773.8 S-15607.8 S-24424.9
C-0682.3 C-2582.9 C-41,609.3 C-6562.9 C-8428.2
C-10845.7 C-121,001.0 C-141,559.9 C-161,089.9 C-18801.2