Summary
Transcript IDgene_000002346
Gene IDTTHERM_01308050
Length1541 bp
Sequence
TAAACAATAAAAATAAATAAATATTAGGTTGATTAAAATGCTTTCAAAGAGCCTCAAGACCGTTTCTAGCTTATTGGTTCCTCGTTACAGCTTTTCTGCTAACTTCAGAACCGAACATGATACTTTCGGTGAAATTAAGGTCCCTGCTCAAAAGTTGTGGGGTGCTCAAACCTAAAGATCTATCCAAAACTTTGAAATCTGTTAAGATGTTGACAAAATGCCTAAATCCGTCATCAGAGCTTTTGGTATTCTTAAGAAGAGTGCTGCTAAGGTCAACCAAAGATACGCACTTGATGTTAAGAAGGCAAGCGCAATCATGGAAGCTGCTGACGAAGTTATTAAGGGTAAGTGGGATGACTAATTCCCTTTGGTTATCTGGTAAACTGGTTCTGGTACTCAAAGCAACATGAATGCCAATGAAGTTATTGCCAACAGAGCTATGGAAATCTTGGGCCAACCTTTCTCTAAGGCTGTTCACCCCAACGATCACGTTAACATGTCCTAATCTTCCAACGATACTTTCCCCTCAGTCATGCATATTGCTGCTGTTATGGAAGTCCACCACACCTTACTTCCTGGTTTGAGAGCTCTCTTAAAGGCTCTTGAAGACAAGCAAGAAGAATTCAAGCATATTATTAAGATTGGTCGTACCCACACTCAAGACGCTACTCCTCTTACTCTTGGTTAAGAATTCTCTGGTTATGTCACCTAAATTAGAAATGCCATCCACAGAATTGAATCCAAGTTACCTGAAATCTCTGAACTCGCTCAAGGTGGTACTGCCGTCGGTACTGGTCTTAACACCTACACCGGATTCGCTGAAGCTATTGCTGAAGAAGTTAGCAGAGAAACTGGTTTCAAATTCACCACTGCTCCCAACAAATTCGAAGCTTTACAATGTAATGATGCTCTTGTTGAATTCTCTGGTGCTCTTAACACCACTGCTTGTGCTCTTATGAAGATCGCTAACGATATCAGATTCTTGGGTTCTGGTCCTAGATCTGGTTTGGGTGAATTGTTATTACCTGAAAATGAACCTGGTAGCTCTATCATGCCTGGTAAGGTTAATCCTACTCAATGTGAATCCTTGACTATGTGCTGCGCTTAAGTCATGGGTAACCACGTTGCTATCTCTGTTGGTGGTTCCAATGGTCACTTTGAATTGAATGTCTTCAGACCCATGATTATCAGAAACATCATTCACTCCGTTAGATTATTGGGTGAAGGTTCTTTATCTTTCACCAAGAACTGTGTTGTTGGTATCAAGGCTGATACTAAGAGAATTGACCACCTTATGCAATAATCTCTCATGCTTGTTACTGCTCTTAATCCTTATATTGGTTACGAAAAGGCTGCTAAGATTGCCAAGAATGCCCACAAGAAGAATCTCACTTTATTGCAATCTGGTCTTGAACTTGGTTACCTCACTGAAGAATAATTCAAGCAATGGGTTAAGCCTGAATAAATGCTTGGTCCTTCTGAATATGTCAAGAAAAACTGAAAAAGCAATCATTTAATAAACCTATTTTGATTAATGGGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-132,679.1 L-234,096.0 L-338,389.6 S-025,160.8 S-311,635.8
S-64,317.9 S-96,740.7 S-125,810.0 S-158,956.8 S-245,481.3
C-01,474.6 C-22,089.0 C-43,525.7 C-61,767.4 C-82,616.5
C-102,791.8 C-123,426.3 C-142,513.6 C-162,743.0 C-182,241.1