Summary
Transcript IDgene_000002467
Gene IDTTHERM_01377900
Length781 bp
Sequence
ATTAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCAAAACAGGAAAAAAATCAAAGAGATGTACAGAATGAAAGGTATCTAAATGCTCGATAAGGCTGAGTTAGTCATTTCTGATATCTAAGAAACTAAGTTAAAAAAGCCTTTTTTTGCTTACATTTATTAGACAATGAAAAATGAATTAACTGATAAAGGCTACTCTGATTTTAGATTTTTAGGACATGGAGATTATGGATTAGTTCTGTTAGCAAAAGATTCGAAAACTAACATGAGGTATGCCATCAAAGGTGTTTAAGTTAGGGATCTTGATGGAAACCTTGAAGAAGATCTTAACAATCAAGTGAAAAAAGAAGTAGAAATACTCAAAAAATGTAGAGAATCTCCTTATGTAGTCAGTCTTATTGATTAATTTGAAGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCAGCTAAATTTTAGAAAGGAACTAAAACAAAAGACTGAATGAAATATCAGCAATCAAATACGCTAATGATATAGCTCAAGGCCTCTACTACATTCACTAAAAGAACTACCTTGTTAATGATCTGAAAATGGATAATATCTTAATTGACTACCATGGAAATGCAGTTGTTTCTGATTTTGGTTTGGCAGATAACCTAACAAGCAAATCTGGCTATACTATCAATCAATATATGGGAAACTTCTTGTATCAAGCACCAGAGTGTTATGATCCAGCTGAACCATACATAGGTAAGATTTATCATGACGAATATTTAAAATTAGG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,063.5 L-2656.8 L-31,567.0 S-0494.2 S-3499.8
S-61,296.9 S-9694.8 S-121,356.1 S-151,182.1 S-241,475.0
C-02,014.3 C-2625.5 C-4727.5 C-6309.8 C-8647.3
C-10255.7 C-12228.9 C-14457.2 C-162,047.5 C-18671.9