Summary
Transcript IDgene_000002490
Gene IDTTHERM_00723090
Length1653 bp
Sequence
TAAAACTATATCTTAAAAAAAGTATTGGATTAAAGTAAGAGCAAAAATTTGAAAATAACTAGCATCCAACAAACAAGCTATTAATCAATCAAAAAGCTATCCTCAAACATATTATAAGCAACTAAAATATTATGAGTGACCCTATTCTAGCATAATTTAAAGAGGCGCTTAGGATATCTCTACTATATTTTATTCATTTTGCAGTTTTCATCCAGTGTTTCCTCATGTCCACTCTTCTTTATATCTTAAGAATAATTCTACACCTTTTCACAGCAATCCCTCAATTAAAACACTTGAGAAAATCTTTGATGAGATTTTTACCTTAAATCAATCCTGATGTTTATGCTAAAGCAGAGGATTTAATTATGAGTCACATTGAATACAACATTGAAACTCATAAAATTCTCACTGAAGATGGTTACTATTTAACAGCCTGGCGTATTCTTTCTTCAGATAAGAAGAAATCTTAAGAAGCTCGCAGCAAAGCTCCCGTCATTTTGATGCATGGACTTTTAGATTGCAGTTTTTCTTGGTTTGTTAATAAAGAAAGATAGATGTGCTTGCCTTATATTTTGGCAGACTAGGGCTATGACGTTTGGTGCATGAATAACCGCGGTAATAGATACTCCTTAGGTCATAAGTACTTCAAACATATTAAATCAAATCCTCATTATTGGAACTATGGCTTTGATGAGCTAGCAAAATATGACGTTAAAGCTAATGTCTAATATGTTTTAGACACTACAAGCCACTCAAAAGTGTTTTATGTAGGCCACTCTTAAGGCTCTACTTAAATGTTTGCAAAATTAATGGAAGATCCTTAATTCTAAGAAAAAATTAAAGCTTTCATTGCTCTCGGTCCAGCTATTTATATTTAAAACTTGGCAAGCAATTTCGTAAAGAAAATGTTTGGATGTGGTTTCTATCAACTTTTAGATAAATTGGGATACAGAAACTTCTTAGTGCTACCTAAATCCATTTCTAGAAGAGTTGGAGCACTGTGCCACTATTTACCATTTTTATATGATATCGGTCTATTTAAAGTTATGAATTTACTTTGCGGCTTCCCTGTTGAAAATAAAATTCCTCGTGACAAAATTTCAGTTATTGTAACACACGAACCTGGTGGTGCTTCAGTTAGAAATATTTTATAATGGGAACAATTCATGAAATCTGGAGAGTTTAAAAAGTTTGATTTTGGAGCTTAAAAGAATATGAAGGTATATGGATAAACAAAACCTCCTTGCTATAATACAGAGAATCTTAAAAAGATAACAATTCCTCAACACTTGTTTATTGGTACTTCAGATATTGTTGGAAATAAAATAGATACTGATCGCTTACTATAACTAGTTAATCCTGATTCTTCCAAGATATATACGCTAAATGACTATGCCCATCTTGACTATGTATGGGGAACTGATGCTAACACTGTACTTTACCCCTAAATAATAAAAATATTAAAAGCTCACCAAACAACATGAAAAAAAAATGTTAAATTATTATTCTATTTATTTATCAATATTAAAATAAAATATAAATTATAATTTCCTTCTCTATATCTTCATATACATTAACCTTATTATCTATACATTAATTCTGTATTAAAATATCCATTTAAAGTATTCCATAGCTAAATTTCTCATATCAACA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,258.8 L-28,970.8 L-38,318.4 S-06,968.5 S-312,522.8
S-611,851.8 S-912,522.1 S-1211,636.3 S-1511,716.6 S-2412,464.9
C-017,595.6 C-24,668.2 C-49,769.4 C-68,052.7 C-86,966.1
C-106,435.5 C-126,686.3 C-149,940.1 C-1612,050.8 C-1811,395.0