Summary
Transcript IDgene_000002634
Gene IDTTHERM_00584990
Length2898 bp
Sequence
TACCAGTAAGAAGGGTAAAAGATATTTAAAAAAAAACTTTTTAACTAAAAGAAAAGTAATGATATCATCTAAAGAGAAACTAAAGTAGGTGATATTCTTTCAGACTTGTTTAATGAAGTGGTTGGTGGGAGAAATAATTCACAAAATTTGAACACAGGAAATAATAATTAAAATAACACAAATAATCTTGATCCTTAAATTCAATCTCAGAATAACTAAAACGTCATTTCTTTTATAAACCAAAATGGTAACAATTCTAACAACAAAGATATCCCTCTGACTCCATCATCTATTAAAAAACCAGAATATGGAAAATCGAAGACTTTCTTTTCATAAATGAACAAAAACACTAACTTGGGGTACATGCAATTTTAGGAAGATATGATTAAAGCTTAAGTAAAGTGGAAAGATCAAATTTTTGTACTTAAATTTTTGCTCTTGGAATTAGAGACTTCTGAAAATAATTCAGAAATTTTCATTCTTGTTTTAGTGGACCCACTTTGGCAAGAATATTATAATAAGAGAATGGAAGAAGTTTAAAAATATAAGATGAAGATGTTTGCTTCTCTCTCTCATGAGCTCAGAACTCCTCTAAATTGCACTATATCCATGTTAGAGGGACTTGAGTAATTTATTACAGATCCTTAGCTTATTGATGATTATCTTTATCCAGCTCTTCATTCTCAGAAGCTTTTACTCAATTAAATTAATGATATTTTAGATTTTGCTTAGATTGATAGTGGAAAATTTAAATACACATTTGTTGATTTTAACTTAGAAAAATTACTTCAAGATTGTTAAACTTTGATTTAAATGCAAGCAACCGTTAAGTCTATAGATCTTCAGCTCATATATGATGCGAGATTAAATTTATAAGTCAAGTCAGACTAAAACAGAATAAGATAAATTTTGTTAAATTTTTTGAGTAATTCTCTCAAATTTACTCCAGAAAACGGTACAATAAAAATAATAGCAGAGCCCATGTTTATTAACGAGACTAATAGAGTACAGAAATATATTAGACTCGTTGTTTAAGATACAGGTATAGGAATGAAGCCTGAAACTGTATAAAATATATTTAATGCCTTTAACAAAACCGAATATGAGTCAGAAGGAATGAATAGTCAGGGATGTGGTCTTGGATTGGCTATCAGCTAAAGTATTTCGAAAGGTCTTTGCACCACTTAAAATTAAAACAGTACCTAATTCAATATTTTATCTGAATATCAAATACCTTAGAATTGGATTGGAATATAAGTAGAAAGTTAATATGGTTAAGGAAGTTCATTTTCATTTATTATTTAAGATATGAATCCAAAGCCTCTATAAAATCCTTAATATACTCATAATAATTCTTATACTCACTCAGTTTTACCTCTAGATATGATTAATGAAGAAGAATTAGCCAATTCTTATATTTCAGTAAAAAATGAAAACCCAGAAAATATTACATAAAATACTTAGCAGTAAGTTGTTGTTATCGGTTAGAATGAAATTGTGTCAAAGAATCCAAAGGAAGATAAAGATCATTCCCTGATGGCAGATTCTGCTTGTATAAACGATGGAAGTACATATCAAAATAAGGTTCCTTAGTATATGGAGTTTGGACAGATAATTGACATCCATTACAGAATCAGTGATGTTGCTTCTAGTAATAACGGATCTCCGTTGCATAAGCCATATATTTAATAAACAGCTACCTAGCACAACAATTTGACTAATACTTAAATAAACTCACCATAAAATATCACTAAAATTGGTGAAAATTAACAATATATTCATTCAATGTAAAGTACTAGTACTTCAACATAACAATCTCTTAATAAACTGAATTAAAATACTTAATTCTCAAACAATATAAACAGCTTAAATTCTATCATCAATAATAACCAAAACTAAAAAATAATTAACAGCAATCAGATAATGGTTACAATAGATCCAGATGAATAAATTAAAAACAATATATCTTCTTAGATTGAAAATTAAAAGAATTCTTCTTCTACACCCACAAGCTAGCTCAGAATGAATTTCTTAAATGATACTTCCTAAATGAAATACTCTTCTTCTAATTCTATATCAAACAATCACTCTAACTCTTCATTACCCTCAAAAATTATTCCTAGTAGTTCAAGGCTTACTTCAAATCTATCACGCACTTTAACTAATAAATCTCTATCTAAAATGAATTCCACTGCAGCCTAAGGTTTTAATGGATATCACTCTAAAAGTAATCTAAATGAAGTAGAAGGAGCAAAACTTATGTTACATCTTTAGTAGTACATAGAAAATTCCGTTTGTGAGAATAAATGTGCTTCTATCTTAATTGTTGATGATAATCAATTTAATATACTAGCTCTTAGTAGAATGCTATAACAATTTTTCAATGCACCAATTGATAAAGCATTTGATGGAAAGCAAGCCTTTGAAAAGATTTGCTATAGGTATTAATAAAATAAGCCAATATAAAGTTGCCCTAAATGCCTGAGATATGAAATAGTTTTTATGGATATCGAAATGCCAATATTAAATGGATATGAAGTTATGAAAGAATTAACAGACTTTTTTCATGAACATAAAATACATAAGGAGGATTTTCCTTACATCATAGCTTGTACAGCTCATGGAGGTGACTAAGAGCAAGTGAGAGCTAAAAATTCTGGATTTGATGATTATATTTCCAAACCAATCATGAGGAACGATATATAAAAACTACTTTGCGATTGGTACTATCAAACTCATAGCCAGAATTTTACTTAAAAGGGAATAAACTAGCAAGGAAGTTTAATAGGAATGAATACTATGAATGATTTAAATGAAATTAATTAAAAGTTAATTTGAATAAATTATCTTAAAATTTTAATAATAAGTTTAAAATAATATTTTAATGTAGATAGGTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1398.1 L-2459.9 L-3502.2 S-0464.6 S-3783.1
S-6664.6 S-9782.3 S-12750.5 S-15858.2 S-24941.2
C-01,493.1 C-21,336.7 C-4630.6 C-6703.3 C-8690.1
C-10735.9 C-12615.5 C-14565.9 C-16682.0 C-18936.4