Summary
Transcript IDgene_000002686
Gene IDTTHERM_00773500
Length518 bp
Sequence
TTATTTATCAACAATATTTAAAAACAAAAATGGACGCAGCTAAAAAAGTAAACAAATTCATAATGAAAAATCCAGAAAATGCTGACTTTAATTAGTATTGGTATTCTCCAAAGACTATCGAAATCTTAGTCAATCAGGTCTTGAAGCATGGTAAAAACTGTGCTTTCTTATCAACTCCTAGTATATTTTATTCAATTAATGATGCTCAGTTTTTGAAACAATGCTATGTTTTCGAGTTTGATAAAAAATTCGAGAAAAATAATCCTAATTTTGTTTTCTTTGATTTTCATAAACCTGAAGACATTCCTGCATAATTTCACAATTTTTTTGACTTCATTGTAATTGATCCTCCTTTTATAACTCGCGATGTTTGGGAAAAGTATGCCAATGCAGCAAAAATAATTGGTAAAAAAGATGAAAATAATAAATTTGTAGCCAATGTATTGGCATCTTCAATCGATGAAAACGATAAAATGTTAGATGAATTGCTTGGCCTTAAAAAGAGAGTAGCACGTCCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1699.6 L-2751.6 L-3340.1 S-0271.5 S-3249.2
S-6280.4 S-9258.7 S-12238.2 S-15268.8 S-24234.1
C-0194.9 C-2147.5 C-4260.9 C-6287.3 C-8135.6
C-10120.3 C-12184.3 C-14193.1 C-16176.9 C-18150.1