Summary
Transcript IDgene_000002695
Gene IDTTHERM_00773690
Length1478 bp
Sequence
AAATAAAATAATAAAATAAACGTAAAAATAAATTCAATAAGTATCAAAAAACAAAAAGATCCATAAACTAAAACATAAAATGTCAGTTGCTAAGTAAACCGCTAGATGCCTTAATGGCCTTAAATCCAACGTTGCAGTTGTCTTAGGTGCTCAATGGGGTGATGAAGGTAAAGGCAAACTTGTAGATATTCTTGCTGAAAAGTATGAATATTGCGCTAGATTCAATGGTGGTGCTAATGCTGGTCACACTATCATTGCCAATGGAAAGAAATACCCTTTCCACTTACTTCCTTGTGGTATTCTTTATCCTCACACCAAGAACGTTTTGGGTAATGGTACTGTTATCCACTTATAAACTATGTTCGAAGAACTTAAATAACTCGATAGAGATCACATCAACTACAAGGGTAGACTTCTTCTCTCCGATAGAGCACACTTGGTTACTTCCCTTACTATTGCTGCCGATTCTAAGAGTGAATCTTCTTCTAAGAATCAATTCCTTGGTACCACAAAGAGAGGTATCGGTCCTACTTATGCCAGCAAAATGAACAGATATGGTTTAAGAGTTGGAGATTTAAAGAATTGGGATACTTTCTTGTTAAAATACAAGTACCTCCAAGGAAAGTTTTCTGAATAAGGAGTTAATGCTGGTAGCGAAGAAGAATTGTAAGAAATCAAGTTATTAAGAGAAAGAATGCTTGCCAACAATATGATTACTGATACCGTCGTTCTTATGAATGAAGCAATTAAGCAAGGAAAGAGAGTTTTAGTTGAAGGTGCTAATGCTTGTTTATTAGATATCGATTTCGGTACTTATCCATATGTTACTTCATCCAACACATCAATTGGTGGTGTTTGCACTGGTTTAGGTATTGCTCCTCATCACATTGAAACTGTTATCGGTATTGTTAAGGCCTACACCACTAGAGTTGGAGAAGGTCCTTTCCCTACTGAATTGAATGATTAAAATGGTGAACATTTGAGAAAGGTTGGTCATGAATTCGGAACTACAACTGGTAGACCCAGAAGATGCGGTTGGTTGGATATTCCCTTATTAAGATACTCTCATATGATTAATAACTATTAATCAATAAATATCACCAAGCTTGATGTTCTTGATTAAGTTGACGAAATTAAAATTGCTACTAAATATACTGTCAATGGAGAAGAAATTCATTTCATGCCCTCAACTATTGAAGAGTTATCTTAAGTAAAGGTTGAATATACTACTGTCAAAGGATGGAATCAAGACATTTCTAAAATAAGATCTTATGATAAATTACCATAAAAAGCTAAGGATTATCTCAGCACAATTGAAGAATTACTAGGTGTTCCAGTTTCTTGGGTAGGAACTGGCCCTGAAAGAGAAGCTATGGTTCTCAAATAATGAAATAATTAAATTTATTTTTAGTTAAATTACTACATGTTTACATGTTTCATTTATTATACTTTCAATAACATTACCAAAAAATAATCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-116,565.2 L-220,003.1 L-320,217.2 S-024,607.7 S-311,813.3
S-64,658.6 S-93,981.2 S-123,871.5 S-154,042.4 S-243,610.0
C-04,535.0 C-22,830.4 C-42,753.3 C-62,418.4 C-82,127.0
C-105,185.4 C-124,665.4 C-145,746.6 C-165,695.5 C-184,675.9