Summary
Transcript IDgene_000002703
Gene IDTTHERM_00773780
Length2153 bp
Sequence
AAAAAAAAGCAAATGAACTAAGATAATTTTTCTAAAACTTGTTAGGAATAGTTGAAGGAAGTCATAGAAATTATTAAAGATACTTAAAATTTTATTTCTGAAAACTAAAAAAGAGTTAGCTTTTAGAGATATTTAGGTCAAGAAATATTTTGGGTTCTTCATAGATGGCTTGAAACTATATTTTAGTAAAACTTTACTCATATATCATCAAATATAGAGCCTTCTGTTTAGAGATTTCTCTAATAAATTAAAGGAGATTTTTTGAATATTAGAACTTTAGTTTAGAAGCTTAAATTTGAATTTAATTCAAAATATGAAGACGAGTTTGAAATAATAAAAAATATTTAAGAAGGTTTATAGAATTTAATTAAAGTAGGTATTGAGGGATTTAATAACGGAATTGTTAAGATAGAAACTAAAACTTCTTTGGATGAGTTCTAAAAATATTTGACACTTCTCAATTTTACAATATTACAATACAGATAAATAGATAGCTAATTCTTTAAGTGTCAAACTGAAATGATGAAATATGGTAAGAATAAGTAACCTTATAAAATTGATTGTCCATATTTCATTATTGACCACACAGTTACTCAATAAGCAACACTTGAAGCTGATGATGTGTATGAAGGACTTAAAGCTTTCTGCCATCAATATCTGAATAAAACTTTGCACAAAGAAATACACCTCAAGAAACTTGAATTTTATCTTGATTTTGATAACACTGGTTAAATTTAGTTAAGTGATGTTGATGACTTCTTTACTTTTGTTTGGTGTAATCCATATGAAAGAGAGTAATTCTTGTCAGAAAAGGAATTCTTTAAATCTGATGAAAAGAAAAACAAATACAAATTAGTCCTAACATTAAAAAAGCAATCACCAAACTTTGATCCTTTATTCCCTAGATAAATTTATATTGATGAATATGGAGTCGTTCCCTAAGACAAGAGATAATCTAAAGACAGAGAAAAAATTCGTAAGCCAGTTAGATTTGGAAGAAAAGCTATGAATAATAATAACCTTATTCCTTGTGACGTCTATTTTGGATAAAAGGAAATGACTATCAGTAAAAGATAGTTTGTAATTAAGTCTGACTAGGATGATTACTATGCTTATTGCATATCTACTACCAATCCTACTGAATTCTTGGTGATGACTGATGGTTGCTTTATCACCAAAGGCTCAGTTATCACTTTATCTGATAAGGTTTGCTTTATAGTAACAGAATGCGTAGTACCTCTTGACGAAGAATAAGTAGTAGAAAAAATGGAAGAAGAGAGTATTATTGGAGATGGACCAACTGTTAGAAGAGGTAAAAAAAATAATCCTGCTCTTGCTTAGATTAAAAGCAAAGCTGACAAAATGAAAGAAATATAAGACCCTAAAGACTACAAAGAAAAGAATATTGCTGATGAGGATGAAGGATTAAAAGTTGAAAATGAAATAACATAAAAAGATGAGCATAAAACTTTTGAAAAGAAGAAAGGAGGTATGAAGGATATTAAAGAGTATTTCTAAAAGAAGATGAACAATGAAAAAATTGATGATGAGCAAGCTTAATTTGTTACTTAAGAATTTAAAAATCAAAAGAAGAAGTAAAAAGATGATGAAGAAGATTACAGATGTTTCCCTAATAAGGATATGACAACGAAATGCACAAGAAGAAAAGGTGAGTGCTATTTATAATTAGAGTTAGACTGGTGTGATTTGGAATGTGAGGATTAAATAAGAGAGACCCTTAAGAAGTTTAATTAAATTTAAAGAGAAAAAAAACAAGGTTATTTTACCATAGGAACAGCTAAAGGATTAGAAATACCTATTGAAGACCATTCTATTAAAGAATTCTAGTGCTATTTTATTTATAAAGAAGAATTTAAAAAATGGATTTGTATGGATTACAACTAAAACATTATGGCTACAGCTATTTAGAAAGACTAGTACACTACCGTTGCATTTAAAGGAAATAATGATAAAAATCACTCTGAATTATTCAAACTACAAAAAGGTGCAGTAATTGTTGTATCTGGAAATTTCCTTGAAGTTGATTTTGTTGATGTTGACTTTGATAAGAATTAATGATAAATAAATAAATTAATTAATTAATTATACAGCGTGTGTGTGTGTATTTTTATTAATTTAATAAAACAATTTCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,950.3 L-21,831.8 L-31,995.0 S-01,740.3 S-31,698.5
S-61,824.4 S-91,923.5 S-122,410.9 S-152,472.0 S-242,490.7
C-01,978.9 C-2642.9 C-41,237.2 C-61,471.4 C-81,579.4
C-101,627.4 C-122,196.5 C-142,288.2 C-162,242.3 C-182,629.2