Summary
Transcript IDgene_000002742
Gene IDTTHERM_00649420
Length1484 bp
Sequence
TTTTTGCTTTATTTTTTGAAGAATTAAAAATTTATTTGAAGTCAAAATTAGAAGAATGTTTTCAAAGGGTTTATTAACAAAAGTTTTAGGGAAGAATTTATTTAAATAATGCGGTCTTCATAATACTTTAAAGTATGGATTTGCTTTCCCAACTTAACCTTCAGACTACGCTAATTTGAAGAAGCTGTCATAACTTATGAATGCTAAATAATTAGATATTAATGAGGAAATCGATTATGATGGTTAAGTTAGATTAATTAATTCCAATAACAAGCAATTAGGTGTCATGCCCTTCGAAGAAGCTTTCAATAAAGCCAAAGATATGAATTTAGATATAGTTCTCGTTAATAGCCAATCTAACCCAGTTATTTGCAAAACAGTTAACTATAAAGAAGAAATTTACTCCAAATTTGCTAAAGAAATTATTTCTTAAGAAGCTGAATCACGTAAGGTTGATAGCAAAAAGCCTAAAAAGTAGATCTAGATATCTATTAACATTTCAAATGCAGATATTAGAACAAAGGCATAAATCTGTAGGGATATTTCTAAAAAGAATCCATAGATTAAAGTCTTCATATAAACAAATGATGCCTAAGAAGAGTAAGCCAAAAATATTCTTTACACCTTTAAGGATTTAGTAAAAGAAGACTTAGTTAGTGAACATGACTTGATGGTTAGAAGTTTATTAAAAGACGAATTAGATTCTGAAGATTTATTTAACGATAAGAAGGCTACTAAGCAAGTTGAATTGCACTTATAAACTATTGAATTCAATCAAACTTAATCAACATACTCTACTGAATTAATTAAAAAGCTTGTTGATTAATATCTTAGAGAACTCAACAATCCTAAGAAAGATGATGCAGTCATTGAAGAACTCAAGACATCAAGTAAAACTCTTAAGCAACTCGAAAGATTTGAAAGCAACAGCAAATTGTTGGTTAGTGAATAGTCTCTTGAAGAATAAATTAATGAATTCGCTAAGGATATTAAGGATGAAGAAGAAGATGAAAATATGGATAAATATCTTTCTGCCTTAGAAGAAATTTCAAAAAGATAGAAGAGATCAATTCATGATATTTAGGATGAAATCGATAATTTAAGATTTAGACTTTAGACATCAAAAGAATAGGCTTTGGTTCTAAGTTTGTTAGAAAGAGAAGAAAAGCGTCTTCGTGACTACAAGAGAACTTTAAAGCTAGCAAAAGCTGTTAGAAATTGATTACAAAGTTTTTTTAGTGGAATATTTAAAATAATTATCTTCTTAATTTAATATACGCAAACAAAAATAAATATGATATGAATAAAGAAAGATGGTTTAGTTATATTTATTTCTCCTTTTAAGTTTATACTGTTAAAAAAGTGAGTGAGAATAGTTTAAAGATGATTGATTTAAAACAAATCTTCAAATTAATATTTAATTTTAATTTTGTATATCATTACATGTTTCTTAGTTGAGAAATACATTTCTTTTTCTATCTTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,329.1 L-24,289.0 L-33,153.3 S-01,782.6 S-3281.8
S-6381.8 S-9469.8 S-12423.9 S-15489.5 S-24601.2
C-0486.2 C-2290.6 C-4567.4 C-6672.6 C-8844.4
C-10673.3 C-12587.7 C-14397.6 C-16426.5 C-18335.6