Summary
Transcript IDgene_000002773
Gene IDTTHERM_00419850
Length875 bp
Sequence
GTAATAATTAAATAAGAAGAAAAAAATTTTCAAAGAATAGCTACTATGACTTCAAATATTGTTAAAGCATTTTAGGGTTTAAATAATTTGACTTTGAAGATGAATTCCTCATTGTTCAATAAGCAATAATATTTTGCTACAAAGATGCAAGCTAGTTCTACATAAAATGGTAGAGACTCAATTGGTAGAAGATTAGGTATCAAAAAGTTTGGTGGTGAAGAAGTATTCCCCGATGATATTCTTGCTAGATAAAGAGGTTTTAAATGGCACGCAGGTCAAAATACCTATGTTGGTAAGGACCACACAATTCACTCTAAAGTCGAAGGTCATGTTAGATTTGAAAAAAAATACACTGATACTAACAGAAAGGTTGTCACTGTTCATGTTGAACCTGGCTAAGTAAGAAATTAATATAATCGTCCTCCTCCTCCATTTGTTTACCATCCTGAACTCTATCCTGAAAGAGCAGTTAACAACCCAGCTCCAACAAACTTTTAGGTTTATAAACAAACTGTTTAAAAGGTTAAAAGAACTGATTTTAGAGGTTCTAAGGTTGAAAACGCAAATAGAAATGTTGTTTAAATTCCATAGGCTTATTTAGAATAATAAAATCACTGGGAAGTTAAATAAGATAATGGATAAAATATTATTCAAGCTATGCAAAAACTTGAAAGTAAATTATTAGGAATCTAATATGAACCTATTATTGAAGATGTTTAAGGAGAATAAGAAGTTGAAGTATCTCAACAATCTAAGTGAAAACATAAAATAACTATTTAAATATGCAAAGAAAGCAAAGTATCAATATAATCTCTGTCTGAATTTATTTTTGCATCTAAAAATAGGATTAACATTATTTATATATTAAAATTGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,635.4 L-22,128.3 L-31,962.7 S-0916.1 S-3309.6
S-6289.8 S-9283.0 S-12181.0 S-15220.1 S-24253.0
C-0222.5 C-2370.0 C-4244.1 C-6274.8 C-8294.0
C-10611.2 C-12418.9 C-14342.6 C-16288.9 C-18228.5