Summary
Transcript IDgene_000002790
Gene IDTTHERM_00420290
Length2804 bp
Sequence
AAAAATAAAGTTAAGGAAAATACAAGAAGAATAATTTAATTTGATTCTTAGAAATTATTATATACAGAAAGGATACGAATTTAAAAATTGCTAGCATGATAGGATAAGTTGTTAATAAAGGTACTTCTAGCGTCTCTTCCTTATTTTAATAGATTAGAAGAGGTTTTAAAGGATTTGACAAAAATCGTTGGGCTACTTCTGCTGAAGTATTCCCTGAAAAGCCATTTAAATATGGTTATGATAAATAACAAAAGATAAAAACTAAGCAAGATAGATAATGGTATGAAGCTCCTGTTGGTGCTATGACAAAAAAAAGATTTTAGACTGCAGATTTCAGAGCATATCAAACTGAATTAGAAGAAGCAGCCTAAAAAACCTTAGAAGGTTAAAAAATTGATGTTGAAGAAGAAGTAGTTAAAGTTGAAAAGGATGAAATTTTTGGAGAACAAGGAGCTCCTAAGAGATACTATGATCGTATTTTGTAGAAGGAACTCTATTTTCATCATAGAAATGGAAAACACTTTTTTGAATAAGCTGACAGAAAAATAAGTTTTTTAAATTAGTTTACTCCTTAAATTGAAAAGGTACCAGAACTCGCTGAAACATTGAAGACTATTTTAAAAATTGCAACTGAATCAGAAGGTTCTCCTCTTAAAAGAGCTGGTATTGACTAAGAGTTTATTATTGAAGATGACTTCTACTCTGAAAATGAAGAATGCAAAAAATTATTTGAAGAAATCAAGCAAAAAGTTTCAAACATGAATTATAGACTTTTACCTGACTTATGCTTAGTCCTTTCTTTTAAACTTAGATACAATAAAGATGTTTTTGGAATTTGGGAGAAAATTGAATAAAATTTTATGTAATCTATTCATCACTATCCTGTCATGGAACTTGTTAAAATGAGATATGCCTCTTGTGCTTTGTCCCCTAAATCACTTTCTCGTGACTGTTTAAAGGCTATCCATGATATTGTTTTTACTGAGCTCCATAATGTTCCTTCTGTATTAGATTTGTCTCACCTTCTTTTCGCATTTAGACATATTAACTCTCTTAAATATTATAATTTAATACTCGATGAAATCTGTAGAAGACCTATTAAAACCCTTTAAGAAGCTATAGCTCTTTTGTTTGTATTTTCTCACTCCCTTTTCCCAAATTACAAGAGAAAGGAGATTAGAGAAAAAGATTAAGATTTAAAAGAAAAGCATAAAATTGTTGATCACCTTGCTGATGCTTTAGCTAATAATGCTAAATAAATTTAGGGTGATGATTTTGTAAGAGTTTTAATTGGTTTGAATAACTTATAACTCACTACCTTCAAGGATGTTTTAACTCATATTGAAAGATATATTATTAAGAATATTGATACTCTTGATGCTTTCTAGACTTCAAATGCTTTATACGGTTTCTCTAAAGCAAACAATAATGCTGGTTTTGGATCTGAATAGCTCTATAAAGCACTTTAAAAGGCTGCTGAAAAGCATTGGTCATAATTCTCAAATGCTGATAAAGCCAGAACCTTTTACGCTTTTGCCTTTTAAGATTTGGTAGATCCTGTTTTCAGAAAGAAATTTATTTAACCATGGCTCAATGAAAATTTAGAATCCAACCTATCACATTCAGAATTACATTATGTCGCTTTCTCATTAATGTTTGAACAAAATAAAGATGCTGAAATATGGAAGAAATTTGTGAAAAATATTTGTAAGAATTAATATGTTGTGCCTGTTTTAAACTACTATCCTATAAAGCTTGCTAGATACTACATGCAATCAATTTTCCCCAAGTGGAATTTCGATATTTACAAGCTTGCCTGCTAAGATGCTGAAGCTACCTGGGATGCTAGTAGATAAATAGATTCTATTATGGAAAACAATAAAGAATGGAAATCAATTGGTGTTTTGCTTTAAAACAGATTAGAGTTCAACTCTATTGGTCTTGACAACTTTGAAAATCTTTTGCTTATTGATTGGGCAATTATGCCTCAAAGAGTTGCTATTATGATATAGGGTGCTCGTCAAACTCTTCCAAACGGAAAACCTACACCACTCCATCGCTTAAAACTTTAATTGCTCGAAAATCACAAGTTTGCAGTATTTAACCTCATTTACAAGGATTTCGAAGCCATTAGTCCTGATTAAAAGATCCCATATTTGAAGAAGACCATTGAAGAACTTATTGCTAAGCAAGATACCTATATTAAAGACGTTGAAGAACCTCAACAATGGTTAAGCTTTATGGATAGAATGTAAGAATTAACCTATAGAAATATCATGATTGGTGAAGCAACTAAGGGTGGTGTTATTGATCCTGAAATTTAAGAAGTCCAATTTGATTGGTCGAAACTTTAGAAAGAATTAAAAGAAAGATAAAAATAAGAGTGAAAACTAAATTCATGAACGCACAGCTTGAGTAAGGCATACAAATTTGAAATTAAATCAATAAAATCCACAAGTATTAACATTTTATTAATGATTACTATCTTATCAATAAATCCTATTTCTATTAGCTATTATTATTAAATATTACTATCACTGTCTATTGCAAAGCTTGTAAGCATTTAACAATACATAAGCTAAAAGAATAAGTAAGCAAGAATGTATGCATGCATGAATATGATCAATCCATAATACTTTAGAATACCTAACCAAATATTAAAGAAATCCTTTTACAACAAAACAGGCGATTGATCTAAGAATGCTCAATTTCATTGATATAAGAATTACAATACTTACTATAATATTGAATTTTTTAAATTTGTAAGTCACTAACTTTATTTAAATTTTTCATATATATGTTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-111,882.0 L-211,031.9 L-38,661.4 S-03,543.3 S-31,286.2
S-61,160.0 S-91,759.5 S-122,008.6 S-152,244.7 S-242,653.1
C-02,263.9 C-2971.0 C-41,991.3 C-61,150.8 C-83,084.7
C-102,938.9 C-122,901.1 C-142,057.1 C-161,613.7 C-181,563.6