Summary
Transcript IDgene_000002813
Gene IDTTHERM_00420540
Length2228 bp
Sequence
AGATTACTCCAGAAATATCATTTTCATCTATTATACTAATTTTGATATTAAAGGGTTAAAATTTGAATTTAGGCTAATAGTAAAAATCTATGAATTAATCATCTTTTTGCTCTATCCATAATGATAGAATGATGTGCCTAGTTTGTCTTTATGGGTAATGTTAGTAGGAAAGCAGAATTATCTGTTTAAGATGTGCGGTTAGAGGTCACAAACATTTAGATCATATTGATAAAGTATATGATATTTCAGAATTATTAGATGTAGAATAATTGAAGAAGTGCTTTTTGTAATAAGACCAAACTATTCTAAGGGAAGAAAATATAAATTCTATTCAGCCCGATTAAATAGAATCTAAGATAGAAAAAATAATCGAGGGCTTTTCTCAAGCAGCTAGATCATGTAAAAAAGCATTAATAGAGCAATTACTTTAAAATGAAAATTCTAACACCTAAGACTAACAAAAATTAATTCAGAGCTTTTATATATAGCTTAAATAGTATTAAAATGGCGAAATAGATCATGTTTCTTTAAATGAGATTGCTAAGCTTTTTACTTATTCAATTCAAAATGAACATAAACAAAATTAGATGGAAATCGAAAATGAAAACGAAAATTAATCATCAAAATAAGAAGATAAGGAGAATATTTCTTTCTAAATTTAATAATGCATTAAAGAATTAGAAAGCATATCTCAGCAGACAAGTTAAATATTTTTAGATTTATGCAAAAAATTGGAATCAAACCGAATCTCCAATTATAATGATATTATTGAAAACCATAAATAGAGTATTTAGCAAGCCAGCACTAAATTGAGCTAGTTTAACTTAGTTAAAGTGTAGAATAAGTAGTTAAATTAGTATAATGGTAATAAATAAACATCAGCATAGAATTAAAATTAAGTTAAATTTGAGATAAAAATAAATGATAACCCATACTTCGATTAAACTTTGTATGAATAACTTAATTAATTAGAAACTATGGATAATTTAAAATAATTAGTAATATCAATCAGGTAAAATATAGTGATAAAAAGTGATTATTTTAATTAGATGCAAAAAGCTTTGCAAAAAAACACCAATTTATTGAAATGCAGCATCTCAATTCAGACTGATACAATTGAAAATACTTAGCAGTTAAAACTTTTATCTAAAAGTATTGGAGATTTAAAAAATCTTAAAGAACTAGATTTAGAAATATGCACATATTAAGGGGATTACTTTACTTAGATCATCACTGAATCATTCTTAGCTAATTTAAGCAATAGTTTAGAATAGCTAAAAAAGCTAAAATACTTAAAAATTAACCTCAAAGACTTTGCTTGCTTTAGCTAAAAGGGGATTAAAAATATTACAACATCTTTAGGAACTTTAATAAGATTAGAAAAATTGAATCTAAGTATATCAGGATATAAAGAAGAATCATTCAGATCTTTGCATTCTTTAAAAAATCTCACGAAATTGAAAAGTCTTCGCTTAAGAATAGTAAGCTCAAATCAAATCAGTGAATATTTTTATATGGAGCTAAATGAGACATTGGCACAGTTAAGTAATTTAGAGGAATTAGAGCTAAATTTCTAAAAGTATTAATTTAGTGCATTAAGTGATTACATAGATTTAAAAAATAATATTTAAAAACCATGTGAACTCACACCTATGGTTTAACTAACTGGAGAGTATTTCAATAACTTGAGTTAGATTTTAAAAGAGCTGACTCAGCTAAAGAGACTTTTTATAATAATTGAAAAAGATTTAACATTTGTTAACGCTGATTCCTTTAAAAATTTGTGTCGAGTTATTGGGGGTTAATCTTTAGGAAATAATATAGAAGTTCTATTTTTGAAATTCAACATTCATGACGAACAGATGAAATAAAGCGAAGTGTAAGAAACATTAATTAATACCTTTAAATAAATGTCATAACTGAAGCATTTATATCTTGATGTATTCAATGTAAGCATTTTTGATTCTAGCTTAGCTGTGCCATTCATAAATTAGGTAGTATCTATCAAAAATATTCATAAAATAATACTAGAAGAACAGAGAATAAATAAAAACACGATAGATTAGATAGCTTAATCAGTTAGTAGCGTGAAAAATCTTAAGTAATTCTTAATAAACACTCAAGATATTCTGCATACATGAAAAAACCTTAGAAATTAAACGCATAGCTAATTATGTATTTTAAATTGCTAATTAAACATTTACAGTTGTTCGATCAGCGCAATTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1143.5 L-2143.5 L-3108.3 S-0112.3 S-3112.4
S-6106.1 S-982.0 S-1292.1 S-15119.8 S-24127.7
C-069.8 C-21,605.1 C-41,874.9 C-61,812.0 C-8540.7
C-10529.4 C-12466.2 C-14338.8 C-16221.4 C-18102.6