Summary
Transcript IDgene_000002909
Gene IDTTHERM_00486790
Length2276 bp
Sequence
TAAAAAATTAAATAAAAGCTAAACAATTTCATCAAATAAAAAAGTAAAGCAAAATTTAGAAATAAAGATAAATGGCTGAGCAAGAAAGTTCATTTTAGGGATCAGGTCTTTTTGATAACCTTAGAAAGTTAATTAACGTCATCGATGAATTAAGAGATGTCGGTTTACAACAATATATTAGATTGCCTAGAATCGCAGTTATTGGTTCTTAATCATCTGGTAAATCATCTCTTCTCGAAAGTATCGTTGGTATCGATTTCTTGCCAAGAGGTTCTGGTGTAGTTACTCGTAGACCTTTAGAACTCAGATTAGTTCATGTGCCTCCCAATGAAAGATAAATCAAGCCATATGCTATTTTCGATGTTGATAAATCAAAGAAGTGGGAAAACTTTGATTAGGTTAGATAACAAATCGATTTCTTAACTGACCAAGTTGCAGGTAAGAGAAAGAAAATTATCAATGACCCTATCGTATTGACTATTTACTCAAATGATGTTATCGATTTGACAATTATTGATTTGCCTGGTATTACAAGAATTCCCTTAAAAGATTCAGACCAATAAGAAGATATCGAAAAAGTTACTAAAGATATGGCTTACTCATACATAAAAGATGAAAGAACAATTATTTTGTGTGTTGTTCCTGGTAACTAGGATATTTCTAACTCCGATGGTCTCTAATTAGCTAGAGAAGTAGACAGAGAAGGCAATAGAACAATTGGTGTTGTTACAAAACTTGATATCATGGATGCTGATACTGATGCAAGAAAAATGATCATGGGTCTTGAAATTCCTTTGAAATTAGGATATGTTGGTGTCAAGGGTAGATCTCAAAAGGATATTAATGACAATAAGAGAGTTTCTAAAGCTCTTGACGAAGAAAGACTTTTCTTTGCTTAGCATAAAGTATACTCAACTATGGATCCTAAGTTCTTAGGTACTAAAGCTTTGACTAATAAGTTATCAAGTGTGCTTTTCTATCACATTAGAAATATTTTACCTGCTATCGTCAAGGAAATTAAAGATAAATTGAAAGAATGTGAAGATAGACTTAAAGACTTGGGTCCCTCTCTTCCAAGAGAACAAAAAGATAAAATGCAACTTATCTGGACCATGATTACTGATTTTACTGAAAACTTTAAAAATACAATTAAGGGTAAATACGATCAAAGACGTTCTAATATTAATACAGAATTATCTGGTGGTGCAGTTATTAAGATGATGTTCAATGAGCTTTATGAAGATTTCATTTAAAAAACCTTTAGAGCAACTAGAGAATATAGCGATAAAGATATTTAAACAGCTATTTAATTGCATTAAGGTGATTCTATTCCAGGTTTCCCCTCAATAGATGCTTTCTTATATTTAATTAATCCTCAATTAGAAAAGCTAAAAGACCCTGCCTTTGAATGCTTAACTTAATGCTACAATTATTTGGAAGGTTTAGCTAATAAGATTTTGAAGAAAATATTCTCAAGATTCCCCACTGTTATGGACGAAATTGCAGATATTACAAGCAGAGTGCTTCAAGCTTAAAGAGATTAAGCAAAAGAAGTTGTTAACAATATTATTGAATCTGAATAAGGTTACCTTTTCACTAATGATTTAGGCTATCTTGCTCACAGAACTCATTTGATTCCAGCTCAAGAATCTGGTAAAGAAGGTTAACAATAGATAGATGCTGAAAAAGCTTTTATTAATGAATTGAGATCTAGAGTAGACGTTTACTTCAATATCGTTGTCAGAAATGTAAGAGACTCTATTCCTAAGGCTATTGGTTTCTTCTTAGTTAAGGCTGCTTAAGAATAATTGTAATATTAATTATATAATGAAATTATGAGAAGTGAAGATTCTCTTGGTAGCATTGCAGAACCTGCCAACATCGCAGAAGAAAGAGATACACTCAATAAAACTATCGAAGTTCTTCAAAAGGCTCATAGAGTTATTAAGAGAGATCCTGATCTTCAACCCAGATATGATGGATAGAATCCTTAAAAGCAAGTTGTTTGAAGAATATGATTATTCAATGAGGATTTTAATATTTCTAAAATAATTACCAAAACTAAAAATCTAAATTATAAAATAAAAATCCAAATAATAAAATATAGAATAAATAAGCAATATCTCTAGTTAAATTTAATTTTGTTAAATCGTTTGCTCAAGAATATCTGTCTTAAATATAATATGTTAACTTAAATCAGTACATTTAGTGTATTTCCATGTCAAATATGTATCCCAGCAATATCTATAAATGTACAAGCTTTTCCATATCAAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-116,417.6 L-213,396.8 L-314,334.8 S-020,883.6 S-315,526.4
S-618,549.1 S-918,473.0 S-1222,310.2 S-1522,931.9 S-2426,124.1
C-011,354.4 C-27,553.4 C-47,885.0 C-68,431.2 C-89,752.5
C-1010,080.7 C-1211,153.7 C-1413,697.3 C-1614,636.1 C-1813,858.8