Summary
Transcript IDgene_000002929
Gene IDTTHERM_00487110
Length1025 bp
Sequence
ATTTAAAAAAAGATTCTCCTAAATAATATATACTTTTTAATTAATAAAAATAAACAAGGAATAAAAATTCAAAGAACTTATTTCCATTATTTTTCATAGCAAATATAAAATAGCAATCTAAAATATACAAATTAACATATCTGAAGCAAGCAAATGAACGATTTATCAGTCACAACTTTCACTCAAGACGGCTATATTAAGTAAGTAGAGTATGCACAAAAAGCAGTCAGCGATAGCGAAACTATTTTAGGTGTAAGATGTAAGGATGGTGTTATTTTAGGTGCTGAAAAGAAATTATAAACTAAACTTATGGTTGAAGACTCTGACAGAAGAATTTATAATATTTAAAAAAATATCGGAATGATTGTTGGTGGTAGAATTCCAGATGGTAGAAATGTAGTCCATAGAGCTAGAAAAGAAGCTTAGGAATACGAAAAATATTTTTCTATGCCAATTTCAGGAAGAATTTTGTCTGAAAGAACAGGATAATATCTTCATGCTCACACTTTATACGGAGCCTACAGACCTTTTGGTTGCTCTGTTATTATTTCATCATATGATCCTATTGATGGTCTTCAATTACATCAATCTGATAACGCTGGTTACTGCTTAGGTTATTATGCTTGTGCTTAAGGATAAGGTAAACAAGAAGTTATGGCCCATTTCGGTAGAAGAAATTTTAGAGATTTAACTTGTGAAGAAGCCCTTCCCTATGTTATATTAGCTTTAAATAAGGCACGTAAAGAAGCCAATGAAGGTATTTATCAATATGAAGTAAGTTGGATCACTGAAAAGAATAACTATGTTCATTGCCATGTTCCAAACGATATTAGAGACTCTGCCCAAGTTCAAGCTGAAGCTATGATTGAAGCTGAAGATTCTGCTTGAAATTGATATATATTATATATTTATAAATTAAAAGAGAATAGTAAGATTGTAGATTTATTATAATTTGTAAATTCCTTTCTGTAGTATTTTTATCTTAGCAAGATACGAGCTACAATTTAAATTTTTATAAAAATTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-19,797.6 L-29,241.4 L-39,062.2 S-012,344.3 S-35,046.9
S-64,918.5 S-93,456.0 S-124,788.6 S-154,803.6 S-244,110.3
C-02,086.7 C-21,699.6 C-42,226.5 C-61,637.6 C-81,951.3
C-103,243.4 C-122,519.6 C-143,067.8 C-163,571.0 C-183,533.4