Summary
Transcript IDgene_000002963
Gene IDTTHERM_00442210
Length3080 bp
Sequence
AAAATAAAAAATAGTAAATAAATAAATAAAAATCTTTAATAGGATTTGAAAAAGCATATTCAAGACTGAAAAGGATAAGAACAGTACATTTAGAATAATATGAGTTTAAGCAGCGTTAGATAGTACTTGCAATTATTGTAAGAAAAGGATAATGAGCTAAAAGTTATTGGATTGGAAAAGTTAGTTTCTGTTGTAGAAACCAACTGGGCTGAAATAGCTGATCATCTTGGAGATATTGAAAATTTATATGAAGATGAGTCATTCCCTAAGAGATAGTTGGCCTATTACTTGGCATCTAAGGTATATTTCAATTTAGAAGAATATGAAGATGCCCTAGACTTAGCTTTAGAATCATAAGAATACTTTTAAGTTGATGAAAACACATAATTTGTAGAAGTTTTAGTTAATACTTGCATTAATAAATATATTACTCATAGATAATCTGACTAGACCACAAAGTTAAATCCTAAATATGAATCTATAGTTGAACGTATGTTTGCAAAATGTTAGAGGGATTAAGATTATAAAAGCGGTTTAGGTATTGCAGTAGAAAGTCGTAGAACTGATAAAATTAATGAAATACTCTCCCAATCAGAAGAATCTAAGCGTGGTGAATTAGTGAATTACTTATATGATGTTTGTATTAAATCATTAAACAGCAGAAATTATCGTATTGAAATTATGCAACTCTTGATTTCATTTTACAAAGAAAAACTTGCTTCTCAAGGATTGCTTCCTCATGAATATATTAATTTAAGTTTAAGCTACCACACTTTAGGAAAGTATGAAGAGTGTTCATAATTAATTGATGATCTTCTTGCCAAAAATATACCTCTTGCCTATCAAGTAGCCACAGAAATTAGTGAAACTTAAAATTACAGCTTTATTAAGAAGGTTATTCAAGCTTTACCAATTGAGGAAAGTAACAGCGAAAAGCGTAAAACAGTCATAGATATTTTAGATGGTAGAACATAAAGAGAAATTAACTAAAAAGTTCTTGAACATTTAAATAAAAGTGATCCTCTCTACATCAAGCAAATCCATTCTGCAGTTGACTCAAAGAAATCAGTTGCTCATACTGCTTTGATTCTCTGTAATTCTATTTTGAATGCAGGAACTGGAAACGATTAATTCGTTAAAGATAATATTGATTGGGCTTAAAAAAGTTAATTGTGGGCTAGATTCGCTTCTTTGGCCTCTTTAGGTATGATCCACTCTGGAAAACCTGAATAAGCTAAATAAATTTTTGCAAGTCATCTTCCCAAGGGATAAGCAGGTGGTAACACCGGAGGTGCTCCTAATTACTACAGTAATGGAGGTGCATTATATGGTATAGGTATTATGCACAGTGGTACACGTGATCCCGAAACTATTAGATATTTAACAGATATTATTAAAGACCCTCAATAAAATAAATAAGAACCTATTCTTCATGGTGCTTGTCTTGGGCTTGGTCTTGCAGGTTTGGCTTCTGAAGATGAAACCTTATTCGAAGTTTTGAAGAATGTTTTAATGAACGACAGTGCAGTAACTGGTGAATCTGCAGCACTTGCTATTGGTCTTATCATGGCAGGAACAAATAATGAAAATGCAATTACAGAATTATTGAAGTTCGGTTCTGAAACACAACATGAAAAAATTATTAGAGCAACTGGTCTTGCTCTTGCTTTAGTTTCTTTCGGATAAGAAGAAAATGCTGACGGTGTTATCGAATCACTTCTTACTGATAAAGATTTTATTCTTAGATACGGTGGTGTCTTAACTGTTGGTCTTGCTTATGTTGGTACTTCCAACAATAAAGCTATTAGAAAATTACTTCATTATGCAGTTGATGATGTTGCTGATGATGTCAGAAGAGCAGCTGTTATCGCATTAGGTTTTGTTATGTTTAACTAATATGAACAAATGCCTAAAATTATGAATCTTTTAGCCATGAGTTATAGTCCTCACGTAAGATATGGTACTGCCATTGCTTTAGGTATAGCATGCGCTGGCACTGGATACTAAGAAGCCTTAAATATGATTGAACCAATGCTCACTGACACCACTGACTTTGTAAGATAGGGAGCTATGATTGGTACAGCTCTTATTTTACAATAAGCCAATTAAAACTCTGAACCTAAATTAGAAAAATTCAAAAAGACTCTTTAAAGCGTTTATTCTAAAAAGCACGAAGATATTTTATGTAAGATGGGTGCCATACTTTCATCTGGTATTATTGAGGCTGGTGGAAGAAATTAAGTTGTTAGACTTGCTTCTTAATAAGGTTTCCCTAAATTAGCTAGTTGCGTTGGTATGGTTATTTTCACCAATTTCTGGTACTGGTTCCCTTATGTTAACTTCATTAATTTGAGTTTTGCTCCTTCTGCTTTAATTGGTATTGATTAAACCTTACGTATTCCTACAGACTTCAGCTTTAAAATTAATACAAAGAAGAGCACTTATGATTACCCTGAGCCAATTAAATAAGATGACAACAAAGATAAAAAGGAATTTGAAAAGGTAACTCTTTCAACAACTAACAAGGCTAAGGCCAGAGCTGCTGTCAAAATTGATGCTAAAGATAGTAAAATGGAAGAAGAAGTTGCTGGTACAAGTTAAGCTGAAAATAAAGAAAAGGCAGAAGAAAAAACTGAAGAAAAAGAGCCAAATTCTTATATTTAAACAAATCCTGGTAGAGTACTTGAGAAATAAAAGAAATATGTTGAGTTTATAGAGAATCATAGATATCAACCTATTATTAAAGAAAGAAAATTCGGTATTGTATTTTTAAATGATACATAAAATTCAGATGATGCCAGCTACCTTGGAGTTGCTAAAAAATAAGCTGAATAAAAATCTGAAATGGTTCCAGAACAAGCTGTTGGTGACTAAAACGATGATATAGCTCCACCTGAGGACTTCGTCTATGATGAAAACTAATAACTTTTGAATTGATTTACCTGATATTATTATAAAATAAATATAAATGAAAATTAAAAAATAATAAATGTTTAAATTAAAATACTCAAAATTAATGCATTTTTATACTTTTAACAATGTAAATTAAAGTGATGTCATTTTTCATTTTGATATCTTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-115,247.6 L-215,149.8 L-315,974.4 S-028,453.0 S-318,989.2
S-612,338.0 S-912,378.1 S-1213,400.7 S-1515,159.0 S-2415,193.6
C-07,113.3 C-27,251.5 C-412,423.4 C-69,924.3 C-814,066.1
C-1014,216.9 C-1215,686.8 C-1411,097.0 C-1613,202.1 C-1810,937.8