Summary
Transcript IDgene_000003151
Gene IDTTHERM_00600110
Length1961 bp
Sequence
ATATAAAAAATTTGAAAATTATTGATAAAAAAGCACTTCAAAAAAAAGAAGATAAGCAAGAAATAACATTAAAATAAATGGCTGCCCAAAAGGATTTAAAGAAGGATAAAAAAGACATTAAGCTTCAAAATATCGAATTTGTTGGTATAGTTAGAGAAGTTCACTCTGGTGATTCTCTCACAATCTAATCAACTAAAACTAATAACATCGCCAGATTTTTCTTGACTCACGTCAGAGCTCCTAAGGTTGGAACCAATGATACACAAGATAAACCTTATGCTTTTGAATCTAAAGAATTCCTTCGTAAGAAACTCATAGGTCAATAAGTAGAAGTAAAATTTGAATATGAAAAAACTGTTAAAGTCGCCAAATCTTGGGAAGATGACAGTGAAGCTACTGAAAAACAAATGAACTTCTGTACTGTGTTCTACTAAGGCTAAAATATTAATCTCTAATTAATCCAAGAAGGTTATGCTGAGTTCAATTTCGCCAGAACAGAAGAAGAAAAATCATAATATCACGATGAATTGAAGACTGCTTCTGAAGAAGCTGCTAAGAAAAAGAAGGGTCTCCACTCTACCAAAAATATCCCTCTCCACAGATTCAATGATATTTCTCGTTTGAAAAATAAGCCTAAACTTCTTGAGCACTTCAACTCATTGAAATCAAAAGCTAGATTAACTGGTGTTGTTGAATTGGTCATTAGTGGTGGTATTTATAAAGTTAGAGTTAATGAAGAACCATACTCCATTCTTGTTCTTTTAAGCGGTGTCAGATGCTTACCTCCTGATAGTAATATTCCCGAATACACCACCTGGTCAAGCAAAGCATTAGATTTTGCTAAAAATAATCTACTTTAGAGAGATGTTGAAATCCAATTAGAACGTATGGATAACAAGGGTAAGTTCCATGCTACTGTTTTAGTGAATAAGTAAAATTATGCAAGCTAGCTCTTATCTTAAGGACTTTGCTTTACTTTTGGTAAGGCTAAACATACTACCGAATATGAAGCTATTGAAAAGGAAGTATAAGCAGCCAAGAAAGGATTATTCGGTTCAAATAAAATAAATATTGAAAGTTTACGTGGTTAAAATTTTGATGTAGATTAAAAAAATGTTAAAGCTATTTCAGGTAGCATTTAAGCCAAGTTAAGCGAATTAATTAACACTGATGAATTCTATATCCAAGAAAATTCTCGTATTGCTGTTTTAGATAAGATGGAAAAGGAACTCGATGATTTTGACTTAGAAGCTTATCCTAAACTTTAATAACCTGTTTAGCCTGGTACACCTTGTGTAGCTCTTTTCAGTGGAGACAATAATTATTATAGAGGTAAAATAGTTAAGAAGCGTAATGATAATAAATACGAAGTATTTTTCATTGATTACGGCTTCTACGATAGTGTTCATATTGATGATATGTGCAAATTACCTGAAAAATGGGCTCCTATTCAACCATTTGCTATCAAGCTCGGATTAGCTTACTGCGTTGGTTTACACGATAAGCATCCCTTGGCAGTAGAAAGTGATGAAACATTCAAAGAGTTAGCTTGGGGCAAAAAAATCCACTTATCTTACAAATACGAAGACAACGGCGTAAAATATGTTATTGTATAAGATGCAGCTAATACTCCCTTGAACTAAACCATCAACTTCCAACTTCTTAAAAAGGGTTTGGTTAGATTAGATGAAGGAGTAGCCCTCCCTGAAGAACTTCAAGCTTGGTAAGAAGAATAAGATTTCGCTAAAGAAAAGAAAATCGGTCTTTGGGCTTATGATGAATAAGAAAATGATGATTGAAGAGATGATAATTGAAATCTGATTAGTTTTTTAGTTAATTTTAATATAATAAAAATTAACAAAATATTTATATTTAAAAAACATAAAATATAAACTATTAAAAAATAAATAACAGCAACATTTTTATAATTACTTTATTTTTATAAAACCATAAAATAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-114,941.2 L-214,632.1 L-310,375.8 S-017,550.8 S-35,177.4
S-63,684.4 S-93,687.8 S-124,251.6 S-155,476.9 S-244,289.2
C-03,918.4 C-24,490.9 C-42,180.1 C-62,711.1 C-82,440.3
C-102,420.4 C-123,070.2 C-142,683.2 C-163,864.8 C-183,171.5