Summary
Transcript IDgene_000003171
Gene IDTTHERM_00600720
Length1370 bp
Sequence
ATTATATATTACATAAAATGAACAAAGTTATTTCATTAATTTTGCTCATTTTAACATGTAGTCATGTTTCTTTTGCGCTAATTAAAGTTAGCATAATAAGAGAATATAAGCCACATTAAAAATATGAAAGATTCCTGAGCTCTGATGCTAATGTATAAGCTAGTCAGAGCAATAAAGTAGTTTCACTTGAAAACTACTTTTAGATGAAATACTTTGGTACTATATATGTTGGTAAGAATTAACAAAAGATGAAAATGCTTTTTGATTCAGGATCAGATACGATGTGGATAGGATCTAAAACTTGCAATACTTGTAGAGATAGTGGCATAAATAATTTATATGACTGTATAGAAACTAATGGCTGTAAGTATACAGGAGACCCTATAGAGACAATTAGATATTTAAAAGGTTAGGTAGATGGATATCTAGCTAGTACCATTGTAAACTTCAGCAATAATAATTCTGCATCTCCTTTCGATTTCAATTTGCTTTTGATTACTAATGTAAAGGATCTAGAATCCTATGATGCAGATGGAATTATTGGATTGACTTACTAGGTAAGCTATAAAAGATAAGATACAAGAAGTCCTTTTGTTAAAGAACTGTTCTAAAGGAAGATAATTAACGATTAAAGTTTTTCAGTATATCTCGGCTTTAAGAAAGATGATTCAGAAATAACATTTGGAGGCATAAATCAAGACAAAGTTAATCCTGGTTCCAATTTCATTTATTATTTAGTACCTCCTATTTAAGCAATGTTTTGGGAAATAAGCGTTTAGAGCTTAATCTTAGGAAGTTAATCTTATGACATGTCCTCTAGTACTACTATAGTCGACTCAGGCACTTCAGTCTTATGTTTTGAGACTTAGACATTCAATAATGTATATGAATTTTTAAAGTAAAATGTAAATGGGCTTTAAAGAAAAGATTTATACTTCACATATAAATGTGGCTAACCTCTTCCAAATATTTACTTTACTATAATTAGTGCAGATGGAAAAAAATACAAATATTCTATAGAATCAGACTACTATACTATTAAACTTAATGGTGATTGTGCTATCCTTATTGATTTGTGCCCAAACAATAACATTCTTGGAGAAGTATTTATGAGAAAATACGTAACCCATTTCAAGTATAATTACAAAGATAATAAAGATGCAATAGGTTTTGCATTGTCTATTGCAGATCCTAAAGATAACTATCTTAATGATTCTGAAAATTAAGATTACACAAAATATTATATACTTGGTGGAGTTGGTGCAGGTGTAATTATATTAATTGTAATTGTAATTTATTACTTTAGAAGAAGAAAAATAAAGTAAAATATGATGAAACAGAATGAGTAATTATATTAAAAGAATGTTAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1576.0 L-2754.6 L-3906.9 S-0347.3 S-31,314.1
S-61,070.1 S-91,124.7 S-121,009.6 S-15946.6 S-24747.5
C-0946.2 C-2397.6 C-4634.7 C-6338.2 C-8250.4
C-10399.2 C-12387.8 C-14665.5 C-16885.5 C-18881.9