Summary
Transcript IDgene_000003281
Gene IDTTHERM_00316430
Length1069 bp
Sequence
TATAACTCTAAATCTTCTAAACTTAACTACTAACCTAGGGATACAGACATTACAAAATATAATTCCAAAATATTATATTAAAATTAGGGAAGGAAATAAGTCGAGCAATAAAATAACTAACAACTGGTTAACCAAAATTAGGGAATTAAGATAGTCAGGACTAACTAATCGAAAGATACATTTAGAACATTAGATCCTTAAAAAATTGAAAAGGAACAACCATTGTTCTAGCATAAAAAGCAAGTTAATGTAGACTATCCTGCATCTTCACAAAACATTTTTGGGCATTACTACAACTAAGAGAATAATAATTAGTAAACAACTTTAAGGGCAAATAGATCTAGTACTGCTTTGATTTCTAATAAAAGCCCTAATAGATCTTAACCTTTAAATTTATTTGCTCCAGACACCAATCCTCCAGTTTATTCAACATTGAATGTAAACTCAACTTCTTTAAAGCCAGAACACTTCTAAAAAAGATTGATAAAATAAAATGAATTTAAAATGTATGACTATGGCTCTTCAGTTAATCTTCCAAATTAATAAGTGATTAGAGAGCCCTTACATGATGCTAGCTAAACTGAAAGATAAAAATTTAATAAAGCTTCTACAAGAAAATACTAACTAGATGTCACTAGTTCAATTGATTGTTTACCTGGAGTTTTTTTCAAATCTCCTTAACAATTTAAACAGCCTCCTAAAAAAGATGAAGCCTTTGCAAAGAGACTCTAAATCACAAGTGTAGAAAAAGATTTAAAAAATGGAAAAAAGATTGAAAAACCAAAATAGAATATTAAAAATCAATAATCTGGTGAATAAGCTGATTTTGATACTACATATAGTACAAAGAGAGTTCATGAAAAATCAAGAGGATAATAAGAACAGCAATTTGAGTTAAAAGATAGCTAAGGACCTATTAAAAATCCTTCTAATCAATACTCAATAAACAGATTCAAAACATAGGTAAGCTAAACATCTTTTTCTAGCAGCACTAGAATGAATTTTTATAAAACTAACTTTGTCTTAGGCTGATATATGAATAATATTCATTTATAAATGCTAAGTAGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1837.7 L-2996.1 L-31,086.0 S-0769.2 S-3348.2
S-6274.0 S-9207.1 S-12187.9 S-15218.2 S-24193.0
C-0175.8 C-2209.7 C-4433.1 C-6149.6 C-8190.5
C-10177.0 C-12104.5 C-14167.6 C-16158.0 C-18142.8