Summary
Transcript IDgene_000003338
Gene IDTTHERM_00318530
Length1038 bp
Sequence
CTTGTGCTCCAGGATATTTTGATGTTACTTAATAGCAAATATGTTAAAAATGTAGTTATTAATGTTTAACTTGTATAGGGTTTGCTTCAAATTGTTAAAGTTGTTAGGTTACAATGAATAGAGTTTTGAGCTCAATTAATACGTGCATTTGTAGTAGCGGATACTTTGATGATGGTTTTAATTTTTAATGCCAAAAATGTCATTATACTTGTAAAAAGTGTATTAATGGTACTAAATCTGGTTGTATAGAGTGTCCTGATAACTCATTTAGATATAGCTCATATAAAACTTTAACTGTTGATAATTCTTTTGAGTGCTTGTGCAACGAAAGATATTATGACGATGGTATTAATCCTGTATGTTAGAAATGCCACTACAGCTGTAAAAATTGTATTGGACCAAAAAATACTGATTGCATACAATGTGATCAAGTTATAGTATATTAAAGAATGTTTATTGCAAATATATCTTCACCAATTTCTTCAACTGGAATTTGCTAATGCGTTGATGGGTATTTTGATGATCTGACAAATATTTTGTGTTAGAAATGCCCCTATCAATGCAAAACTTGTGATATTCAAAAATGCTTGACCTGTGATATAACTAGAGATTTGGTTGGAATGACGTGCTAGTGTAAGAAAGGATACCTAGAAGTAGGAAACTAGGCATGTGATTCTTGTAGTCCTTTGTGTTCAGAATGCAGTTAAACAAGATACAAATGTACAGCTTGTAATACTGCAATTACTTTTAGATAATTAAATTAACAGAACTCTTGTCTTTGCTAAGAAGGTTATTTTGATGCCAGTAAATATGATTCAAAGACTAGAATACCTATATTAGAAATACCAAATTGCCTGAAATGCAAAAAAAACTGTAAGAGTTGTGGTCCTGAAAATCCTAACATATGTTTATCTTGTTATTCTAATTACAACTATGTGTTGAATCCAGAAGATTTATGCGTTTGCATGTTTGGATTTGAAGAAAACAATAGTATTTGTGAGGAAAAATTTTTAGTAAACAATTCATACATAGATGAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1162.2 L-2111.5 L-3127.9 S-0166.2 S-3269.0
S-6183.4 S-9224.8 S-12210.6 S-15230.8 S-24165.7
C-0241.3 C-2758.3 C-4772.0 C-61,339.3 C-81,348.0
C-10663.2 C-12336.2 C-14292.4 C-16381.1 C-18321.8