Summary
Transcript IDgene_000003451
Gene IDTTHERM_00334410
Length2002 bp
Sequence
AAAAGGTTTTTGCTGGGCCTATTTATATTGAATTTGGAAACGTTTATGTTAATTCAGAGATGGTCAAAACCTTTAGAGTTAGGAACGACTTGAGGGCTGCTATATCTGTTAGATTATTTACTGATCGCTAGGAATTGAAAAAAACTTATTAAAAAGCATAAATCATTCCAAGTGGACAAACAGCTGGTTTTGAAATCGTTTTAAATTCTCGAAACCTAGGCCCATTACGTAGCAACATTAAGTATTTCATAAACGAAAAGCATTCGTTTGAATTCTAAATTGTGGCAAACATAGAGCTTGTTAAGATTGAAATATCTAAACCTTTGCTTAAAATGAGTTTTGGAGAAGATAATATAGAAATGAGCACTAAAGAAACTATTAAATTAGTTAATAATGGAAATGCTCCAGGTAAGTTCAAGTGGCATACAAATAACTCTAAGATATTCACTATTACTCCAGAAGAATCTATTGTTTATCCTTAGAAGCCAGTTGAATGTACTATTGTTTATAAGCCATCTTCTGTTCAACAAATAGCAAATACTTCCTCAACTGGTGCAAGCTTTTTGCAGTCTACGAATCAAACATCTGTCTAGGCAATAACAAGAACCGAAGAAGAAAAGTTAATTCTGAAAGTAACAGATGGTATTGAGTAACAGCTTAAATGCATAGGATCGTATACTGAAGCAAAATGTTCTCTCAAATAATAGTCTTTAGATCTAAAAGAAATATGTGTGGCTTAACTGATAGAAAGAACCTTTGAAATAAAAAATAACAACAGATAACCAGCTGTATTTTGTATAGAGGAATCAAAATTACCTGAAGGAGTTATTATTTCTTAAATGAAAGGTAAAATTGGGAGTGATGACACAAAGGTTTTGAATTTAAAGTTTAGCTCTAAGAAAGAGTGCAATATTAAGGGTGATATTGTAATTTTAATTAGAGGAGGAAAGACTCTGAAGTTGCCTTTTTCTGTTTCAACTATTATCCCAGATATTCAAATCAACTAGGATAAATTTGATTTTGGAAACATAACTACTTTAGGTAACCCTGGATAGCTTGAGATGCATCTAACCAATAATTCTTCGATTACTGCGGAGTTAGTTTTAGATTTGAGATACGATGAGGAAAAAGATGGTATGGATGAAGAAAAAGATGGACTTGATTGCCTCGATGTCGCATGTTTAGAATAAGCAGATGAGAGTATTTTACACTCTATAGCTGATCATGAAGAAGAACAATAATAAATTGATTCAAAATCAAAATAAAATGCTAACTAACATATTAACAATAACAATAATGCTGATGATGAATTTGATTAAGAGAATTTAGATGTGTCAGAGTAATCTGAGGACGAAGAAGAAGAAACCAAGCTGTGCAAATATTATTCTTTAACAATATAACCAGGATAAACCCTTCATTTCCAACTAAAATTCTCACCTAAAAGTTTCAAGTAATATAAGTTTTTGTTTCCAATTTAGCTAAGAGGATATGGCCTGATTGATGGCTTAAAAAGATTTATCTTTTGCCGTGGTTTGAAGCCTAAGTTTTTAATTGATCCCTAAGTCTTAGATTTCGGTAAAAAGATTATCACAGCTCCTGATAAACAATCAATAGGAAAGTAGTCTATTCTTTCATTCTCAAACCCTGACAAAAATTCTGTTTCTTGGTATGTTGATACAAACGTATTAGGTAATGACCGTATATTTGATATTCGTCCTGATCAAGGTGAAGTAGGACCTGGAGAATCGAAGAATATCTCAGTATTTTTTAATCCGTTTGAACCAGGTGTTTATGAAAAATAGATCCCATTGTTTGTTAAAGACCCTGATATGAAGATTAACAGTTCTTACATCGATATTACATTGAAAGGAGAAGGTGCCTTCCCTAAGTTGCTTTTTGACAGAAAAGAAATTATTTTACCAGTAGTTCCTTTAGGTGTTGAAGCAAAGTGCGTTTTTAGAATTATCAATAGTGGATATGAAAATCTTAACTTGAAATATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1891.1 L-2905.8 L-3699.0 S-0385.7 S-3385.2
S-6230.8 S-9228.8 S-12203.2 S-15327.8 S-24411.4
C-0559.2 C-2252.3 C-4253.7 C-6121.7 C-8243.4
C-10389.1 C-12624.2 C-14240.6 C-16318.2 C-18509.4