Summary
Transcript IDgene_000003452
Gene IDTTHERM_00334410
Length1447 bp
Sequence
CATAAACCATTTAAAATTTTCCTAATTCTATAATTGAAAGTAATGGGGCTTAAGTGTTTGATATTCTTACTTATCTATCTGGCAAGACGGCATTTAATTTCAAGGCTAACATAGACTTTTCAGCTAAGAGACTTGAAAAAGTTGAAAAATTGTATAAGCAGTATGATGAGTTAATTCGCACATTAAAAATCGAAGGGGCTTTATTGAATCATATAAGACCAGAATATTTATTTAGTTATAACGATTATCTCTTTTATTTAAAGACACTCCCAGAAAAAAAGTAATAAAACTTAACACCTTCTGCGCTAAAAATGCCTGCTTTAAGGTTTTAATACTAGTCAATAGAGGCTTGGACAAGTTTAATTTATTAGATGATCAAAATTTATTATTTATCAAGAATTAATCCGAAAACATTTAAATCTGTTCCTGGTCTTCCACCAGAGAAAGCATAAATACCAGAATATATAGAAGGTAGTAATTTCATAAGTAGTTCTGAGGCTCTCTTGCTGAATTGGTTTGAAATCCATAATGAAATCATTCATCCTATACAAAAGAGAAGAATACGTAATTTTGATGAGGATTTTTAAGATGCAAATCTGTATGCTTCTGTAATTCAATCATACGTTGGAAAATCTTGCTACAAATATTTTAATACAATGAAATCGAGTTGTTCAAGTGATATAGAAATCAATTACAATGCCGAAAAGCTTATTTAAGGATTAACAGAAATAGGTATGCAAACACATCTTAATGTTAAAGACATAGTAAAACCATCGATGAGAGAAACTCTATTGTTTTGTATTTAGCTATTTTTCTCTCTTCCCCACTACATTCCCAAAGGATAACCAATAATCTTTTAATGTGTGCTTGGTGAAGAAGTAGTAAAAAATATTGAGTTGCAAAATCCAACAAACAAGCCAATAAGTTATTGGGTCTAATTAGAACCTCAAGGAGGTGATTTTTCTCTTGAAAGCGATGATAATTTTGTTATTGAACCTAAGTAAACATTTAAATTTAAAGTTAAATTTACCAGTAGAATATCTGAATCTGTGACAGGCCGTATTAGATTTACTAACAAAAAAGAAAGTAACGTAAGTGCTGCTGCACTTGTTTTTGAATTAAAATCTTAAGTGATTGGAAGAATATCTGAAATAAATTGGACTGTTAATGCATAGCTTTATGAAACAGTTGAAAAGTAGATTTAAGTTACTAATAAATTCCCAAGTGAGTCAGGAGAATTTATGATTATCATCACACAAGAAAGATTCAAAAATGCTGAAGAAATGAAAAAAAAGCGTACTAATAAAAAATCTTTGACTGCTCAAGGTGATTAGTAATCACTATCAAATATTAATGATAACACAGCTCTTGCTCCTTCTAAAAAGCAAGAAAACGAAATATTTCCCTCTTTCTTTTGCTAAAAAGCTTCTATTCGCTTAAAAAAGGG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1503.9 L-2663.7 L-3600.2 S-0301.7 S-3261.7
S-6201.0 S-9170.3 S-12188.4 S-15160.5 S-24286.0
C-0406.4 C-2244.6 C-4213.4 C-6172.4 C-8289.7
C-10567.1 C-12459.5 C-14370.1 C-16393.3 C-18568.8