Summary
Transcript IDgene_000003453
Gene IDTTHERM_00334410
Length3012 bp
Sequence
GTCATGGAAACACAAAAATGTTTTATTATTTTTAAAGACCCTAATGTAGGTGAATTTTAGCATGAAATGATTGGAACAGTTGAAATGCCATCGCTTTTACCAGATATTATTCGCTTTCCCTTAACAGGATATCCAACAATTTTTGTAGACGAGAATTCATAATAAGAAGTTGAAATACCTTTTGCAAATGACCCTATGTTAAAAGCTAGAAAGTAAGTAGAACAATTAATAGTTGAGAAGAATAGAGATAAATATATGAGGGGAGATAAAACTTAGGTTATAAGACCTGAGAAATTGAATTTCCCTGGTGGAAATCCTGATAGTGTATAATATGAAATAGAAATGAATCCTCCAAATTCATTTATCTCAATTAAAAGCTAATTTGTTGTCATAAATCCATTCAGATTCACCAAGAGTAAATAGGAAAAATAAGAAAGAAATACTGGAGAGTCTAAGAAGGCGAACTAAAATCACACTGAAGAATCAGGAAATGTTTTGTAAGCTAACTAAACAGGATAAGCGTTTGCAAGCTAAGGAGTTAATAAATATCCCTTTTAATTCCTTTTCAAATAGCCTGTAAAAGACTATAAGTTCAATTTGACTTTTAAGAATGCTTAAAAAACTGATATTCGTAGATATAGATGCGAAATTACTGTTTTCCCAAAACCCATAAAGGCAACATTAGAGTTTAGAGTTCCTGCAAGGCACAGCACAACATAAGAGATTCCAATTATAAATAATACAGAGAGAGATTGGAATATAAAAGTAAATTTAATTTAAGATGCCAAAAATGCACTACTATTTACTGCTCCCTCTCATATTTTGAAAGACTTTTTCGTTAAGAAGAAAAGTACAGGTGTTTATCCTATAACCTTTTCTCCTAATTGGCTCGTTTAAGCAGAATCTAAGCTAAGCTTATTCAACCCTCTCACTAATGATTAATTTGAATATGACCTTAAAGGATTTGGTGAAGAACCTGTAGCAGAAGACCACATAGTTATCAGTTGTAAAGCTAAGTAGCCAACAACTAAAGAAATCGAAATTCGTAATCCGTATACAGATAAGGAAATAGTTTATAGAGTAGAAACAGATCTTATAAATGCATCAGGACCTTCTTCTCTGGCTATAAAACCTGGAAAAAGGGCAAAATATGTCCTTACTTTGAATCCCATATTAAGTGGATAATACACTGGATCAATAACATTTTATGAAAATGACGAAAAATATTTATGGTACACTGTACTCTTGAATACAGAAAGCCCAAAACCAGATAAATGTATTGAGATGAGCACATAAGTGAGGTAGGCTGTCACATTTAGTATTGAAATAAAAAATCCATTAAGCTAAGATGCAACTTTTGAAGTTATGATTAATGGTGAAGGATTAATAGGTGATACATTATTTAACTTACCTGCAAAGTCAGAGGGAAATTATGAGCTTATTTATTCTCCTCTCGTAGTTGGGCGATAAAGAGGTTCAATAGCTTTCATAAATGAGTTGCTTGGAGAAATTTGGTATGAGTTAAGTTTAACATGTGAAGACTAGCCACCAGTTAGAATGAATGTGTTAAGATGCGAACTTGGAAAAGTAGAAGCGCATTAAATATTTTTAGAAAATCCCTCTGAAAAGGAAGTTAAAGCAACAACAAAGGTTTCAAATCCAACTAACTTTGATGTAATACCAGACAACATAATTTTAAAACCTCTTTCGAAGACACCTATACAAATTAGATATATGCCTTCAAATCTTGAAGTTACAGAATAGGGAGAAGTTACAATTTCAACACAAGAAATTGGAAAATGGAAATTTTTAACTTTTGGAATAGGTATACCTCCAACTAAATTTGAGCCTAGATTGATTTCAGTAGGCCTTAATAAAGATTTTTCTACAACAATTCACTTCAAAAATCCATTTAAAGAGAATATAAATGTAACAATCACGTTAGAAGCTACTGGTGAAAATAAAGAAGTCTTCAAATTACTTACAAAAACTAAGAAAAATGAAGGAGAAAAATCAGTTATGCAGGTTCCTGGAATGAATGTCATTTAAATTCCATTTTCGTTTGTCCCTAGAGAAATAAATTGCTATTATTGTGAAATTGTAGTTTAAATGAATGAAAAAATTGAATGGAGATATCCTATTAAAGGTGTTACAGAGAGCGTAGTAAACTAAGTTATTTACCACCTAAAGACTTAATGTAGATCAACAGTTGAAGAAGAAATGAAAATTTAACTACCTGGAATAATGTCCTTTATTACAAATGAAGATAAGTTTGAGTTTGAACTTGATGGCATTTCTGACGAATTCAACACTTTGATTAGATAGAGTTTACAAATAAAGACTGTTAAAAATTACTTGACATCTTCAAATGATCATCTTGAGTTCCAAGCTAAATTTTCACCCTTAAAGCCTTTCAAATAAACAATTGATTTTAATATATTAAGACAAGCTGGTGGGCGCTGGAAGTTTAAAATAACTCTTGAAGCTACTGAACCAAAAGAAGATGATATTATAATAATTAGTTCGCCACTTCATAAAACAACAAGTGTTACTTTTAAACTAACAAATAAGTCCAAGAGTTTTACTCCTTTTACTGCTTCATTTACTCCAGATAGTGATGCTGAATTTACTGTTATGCCCAGGTCTGGGAATTTAGAATCTTACGGTAGAGAAGGAACTACATTTATAGTATCTTTTACTCCTATTGAATATGGAAAGACAAGACAGGGTAAGCTCATAATACAGACAGATGAAATGATGTGGAGTTATTTAGTTAAGGGAACTCTACCAAAATATAATCCTCCATAAATAGAATAAAGCATGATAGATAATAAACTTGATATAGATTTAATCTCTAAATCAGTGCATAATAATCATTCTAAAAACTTTATGGCTGAAAATGTCATAAAAATGAAAAATTCTTAAGTAGAGTCAAATATGAAATAACTTTAGAAACACAATAGTTCACTTTCTCTTTAGCTCAGAAGCAAAAAATTCTGATATTGATATTGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,612.8 L-21,831.8 L-31,787.4 S-01,154.8 S-31,447.7
S-6958.2 S-9613.2 S-12851.2 S-15919.2 S-24899.4
C-01,340.4 C-2689.8 C-4533.0 C-6411.2 C-8925.1
C-101,545.5 C-121,697.6 C-141,037.4 C-161,214.4 C-181,373.3