Summary
Transcript IDgene_000003607
Gene IDTTHERM_00276050
Length1208 bp
Sequence
TTTAATATATTTTTTTGTGTTTAATTTGTGTGAAATTTTATATAAATCGTCATGGGTGAAAAGAAGTACATTTTGGTTTTAGGTGGTTCCACTTTTATGGGTTTACAATTGCTTTAGAATCTATGTTCTAGCGAAAACGAAGACTACGAAGTTTATTACATAAATCGTGGTAAAAAATATTGGAATAATTAAGTTAAAAATATTAAAAATGCTCATCATATCTTCGGAAATAGAAAAGAAAAATAAGAATATAGAAAGCTTATTGAATATGAGAGTAAAAAGTTAGGAATTGATGGAAAAAAGAAATGGACAGCAGTTTTTGATTTTTGTGGCTTTAAATATTCAGAAGTGAAATCAGCTTATGAAGCCTTAAAGGGAAAATGCGAACTATATCTATTCATCTCTACTGATTCTATTTACGATGTCTGCGATAAATCAGTCAGGAAAGAAGGATAACCAATTAAAGAAGAAATGGCATGTAGACCTAAAACTTTGACTAAATAGGCAGAATATAAAAAGGATGACGATTATGCACATCATAAGCTAAAATGTGAGGAATTTTTATACAATTATGTAGAAAAAGAAGAATTACCATTTGTTATTTTAAGATTACCTGATGTCATAGGTCCATTTGATGACACTGGAAGATTTTGGGCTTACATGAAATGGATCACTGAATTCAATAAAAACACATTATACATGGACGATGAAGCTAATAACTTAAAAATGAGCTTTGTTTATAGTTAGGATGTTGCAGATATCTGTTTAAAACTTATAAATATGCCTAAAGATAATATACTACATAAGAGTTATAATATTGCATGTGAGGAAGTGATAACTTTAAAGTAAATGATAGAATAAATCGCTAAAATTATGGATATAAAGTTGGTTAACATAAAGAATACAGATAATGCATCGAAGTTTTATCCATCTGTTGACTGTGGCCCTATTGATATCACGCTTGCTAAATAAATGCTAGGATGGAATCCTACACCATTAGAAGAAGTATTGGAAAAAACAGTAACATTCTTTAAGCAAGCCAAGGGCAAATATAGAGAAGAAGAAAATTATGCAGAAAAGAAGCTATACAAAAAAATTAAGACAGATTGAAAAATGGTTCTATTCTATAAATAGTCAATATATTTATTTGATTTTGTGTTATTTTGTACTTAAAAAATTAATTCTGCCCTGCTTAACTTATTTATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,594.0 L-21,862.7 L-31,562.5 S-0617.0 S-3795.5
S-6953.5 S-91,077.9 S-121,388.8 S-152,176.9 S-241,886.7
C-0843.5 C-29,829.1 C-414,086.7 C-613,139.3 C-83,905.2
C-103,335.4 C-123,080.1 C-143,175.2 C-161,876.6 C-18958.5