Summary
Transcript IDgene_000003698
Gene IDTTHERM_00301840
Length1879 bp
Sequence
ATTAATAATCGCAATCTCTGTAGCAGCCACTTGTAAAGTAACATCCAAAAAATAATTCTAATAACACAAGTAGTTTACAGTAAAGTCCTTAGCATCACTAAGGTAATACTTATTTCCATGACGAAGAACTCTAAGATTTTGAAATTCTAAGCAAATTAGGCGAAGGTTCTTTTAGTACTGTGTATAGAGTTAGACGTGGAAAGGATGGAAAAGAATATGCTTTGAAAAGAATAAAGATGATGAAATTAAATGAAAAAGAAAGGGAAAACGCAGTAAATGAAGTGAGATTTTTGGCTTCAATTAACTGCAGGAATATAATCAGCTACAAATAAGCTATTTATGATGAAGGAGTCAATCAATTATGTGTTATAATGGAATATGCGGAGGGAGGCGATTTAGCTAGAATTATTCGTCATGCTTCAAAAGCAGGTAAATATATTGAGGAAGATATGATTTGGTCATATGCTATTTAAATGACCATAGGCATTAAAGCGTTACATGATTTAAATATATTGCATAGAGATTTAAAGGCAGCTAATGTTTTCTTAGATAAGTATTAAACAAGGGCTATGTTGGGAGACTTGAATGTATCAAAAAAACTACAAGTGAACGGTTTACTTTATACTCAAACTGGTACTCCTTACTATGCCTCTCCAGAAGTTTGGAAAGATAAACCTTACAATAATAAAAGTGATATTTGGAGTTTGGGCTGTGTTATATATGAAATGTGTGCTCTGAAACCACCATTTAAGGGAAAAGATATGGAAGACTTATTTAAAAAGGTATAAAGAGGTGTCTACGATCCTATTCCTTCTCACTTTAGCAAAGAGCTAAACCTCTTCATTGCTTAATTATTAAGGGTAAACCCTGAATAGCGTCCTAATTGTGATGAAATTCTCAAATTTTCTGTGATTAAAAAAAGAATGGCTGATATGCAGCATTTCTTTTCAGATTCTCTTACTCCTTTCTAACAAAAAATGTAATCTGAATTAATAAGCACAATTCGTATTGGGAAGTCTTTACGTGGGTTAAAAGATAAATTGCCTCAGGCAAGATACGAAACAACGGAATCTACTTAAGCTACAACAAATTAAATAACTTCTTAGTCAGAAATTTTACAACCTAATTAATACCACCGTCAAAGAAAAAATAAATACATTTCTCATATATCGTCAAGTAATATAAGTGATATGATGAATTAACAAATAAGCATACCATCTTAACTATTAAATCCGTCTGTAGAAATATAAAGTAAAGGCTTGAATGATAATCACAAAGGAAGTTCAAGTTTGAACTAGAATTCCATTTCTTTAAGATAATCTTAATAACAATAAGTTATCCCTTCTATATAATCATCACCTCCATCATAAAAATCTGAACATATTAAATAAATTATTGCATAAAAATAATAAAATAAATCTTCATTATATTAAAAATAATATTAATACCCACGGTTGCCACTTTAGCATTAATAATTTGATAGTGCCTCTCCAATATAAGCTAAAAGCAGATGTAGTTCTGTAGAAAGTAAGCAATCAATACATAAAAATTAGCTAAGTCTTCATAAGTAATACTACCAAAATAATGATATAAATAAATCTATTAATTTGAATAATTCATAAAACTCTATTGTCACAAATAAAAAACCGATACGAAACAAAGAAAGTAATACACCATAAATGTACTAATTATAAAAAGCAGAAGAACCAATATCAGTCAATTAAAGTGTCCAGTAGCTTTCAAAAGAAATAAAATAATTAAATTCTAATTTATATAATGATGAGATGAATAGTCGCTAGAAAAAAATGTATCAACTTTAAGCTTTATAAAAAATCTTAGATTAAAAATGTTAACTACCTCAAATACTGAAGACATCCAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1501.8 L-2515.3 L-3559.0 S-0597.0 S-3651.5
S-6516.1 S-9672.3 S-12475.0 S-15663.2 S-24722.3
C-01,234.9 C-2314.3 C-4230.7 C-6277.4 C-8397.6
C-10402.2 C-12730.6 C-14791.0 C-16801.5 C-18835.1