Summary
Transcript IDgene_000003777
Gene IDTTHERM_00295100
Length1438 bp
Sequence
GGTAAATCAAAGAAAAAATTCTGATAAAGAATTCTAAAAAGTAGATATTGTTGTCAGCAGCTAAGTTGAAACAAAAGATGACTTAGAATTAAATGTTGAATAAAATGAAAAAATGTATCTTTTCATGCTCTTCTTGATTGGTATAATTAATAATACAGGGTATGTTTTAGTTGGTACAGCTGCTTAAGATATAGCAAATAAGTTTGATATGAAAAACTTTATGACACTCTTTTAATTATCATTGATTGTTTTATCTGGTGTTATGCGTTCAATCAATTCAAAATTCTTCATTAAAATCTCTCATAAGAAGAGAATATTTGTTTGCATTGTATTATCTATTGGCGCCTATATAATTATTGCTTTTTCTTCAAAAGCTAATGGCAAATGGGGTTTCTATACATGCTTAGTTGGATCGGTAATGTGCGGTACCATGTAGGCATTTGGTGAATCTGTAATGTTAGGTTACTTAAAAGTGTTTCCTTCAAGACTTGTAGCTGGATGGAGTAGTGGTACAGGTTTTGCTGGTCCTTTCGGTTCAGGATTACTTCTTATTTTGAAGGCTGTTAATTTAGATCTTTACATCATATTTTTAATCATGATTCCTATTGAGGCAAGCTATTGGTTATGTTTCTTATGGTATGACAATAGAAAGAGAAAATTCTATAAGTCTAATCAAGTAGGTTCAGAAAGCAATTGCAGTGAAAGCCAATAAGGTGAGGAATCACAATAATAATTAATTGAAAAATCAGAAGATGATGATGCTAAAAACAATAAGAAGTTGTCTATTCAAAATATCAAATCAGTGATGCCAAAAATGTGGACTCTAGCAGTAAATCTTGGATTAGTTTATTATCTCGAATACGTCATTGAAACAGTATGGGCAGAAAGAGCACATCCATAATTAGATAGTGATTAATACTCTGATGACTTTAATGGATTCTTAGAAAAAAATGGTTTTGTTATCCTTTGTTTTTGCTACTAAATTGGTGTATTCATTAGTAGATCATCTTTATATCTCATAAAAATCAGAAAAGTATTTATCTTTACTGCAGCTTAACTTGGTAACTTTGGACTTTGGATTTTCTTTGCAGTAAACAAATCAGTACCTATGGGAGTATAAATTCCATGCATGATTTTTGTAGGATTAATGGGAGGAGCTTCATATGTAAATGTCAATTATTTGTTATTAAATCATTAAGAAATAGACAGAAACGAAAAAGAACTTGCTATGAATATTTGTTCTATTTTTAATGATACAGGTGTACTATTATCGTCTTTAAGTGGTCTAGTTATTGATAATTTTATCATGAAAGACTGAAAAATAAAATAATTTATTAGTAATAATAAATTATAAGAATTAATTAATTATTATACGAATTAAGCACATTTTAATTATTGTTATATATTTACAGTGTTCATTTTAATATTAGAATAATTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,806.7 L-22,522.6 L-33,572.5 S-01,997.2 S-33,148.5
S-63,474.4 S-93,736.4 S-123,360.1 S-154,159.9 S-243,421.4
C-03,983.0 C-21,596.9 C-41,391.3 C-61,061.0 C-81,376.2
C-102,826.8 C-123,894.3 C-142,900.0 C-162,569.7 C-182,862.7