Summary
Transcript IDgene_000003798
Gene IDTTHERM_00294800
Length1331 bp
Sequence
CTTTAGCCAACTTTAATTAAACCAAATATATAGTATAAATGGGAATAAAAGGAGTAGTTTTAATAGGAGGACCTTATAAAAGTAATTAGTTAGCACCCTTTACTAGCAGTTAGCCCGCTCCATTATTTCCAATTGCAGGAGTAGAATTGATATATCACCATATTTTTGCATTGTCTTAACTTAAATCGATCACACATATTTACCTGATTGGACTGTATACCTAAAATTAAATTTAGTAGTTTATCTTAAAATGCAGAGCAGAATACAAAAATATATCATTTGAATATCTTTATGAAGAAGAAGAAAAAGGTACAGCAGGCAGTCTTTATTAATTTAAAAACAATTTATTTTGCAAAGAAACAGAAAGTGTCATTCTAATAAATGGAGATATTGCACATAATATAAACCTTTAAGATTTCGTTGATTTTCATAAATCCCTGAAAAACTCTGCATGCACAATCGGAGCTAAACAAAAAGAAGAGCATGAAGACCTATAAAAATATGGCTGTATTATTAAAAATGAATAAACTAAATAGCTTGTTCATTATGTAGAAAAACCAGATAATTATGTCTCTGAGTTTCTTATAAATACTGGAATTTATATACTTTCCCCTCTTTTTAGTTAGATATTAGATTATTCTAAGTAAATTAGAAATAGCTCTCTTTTATAAATGTATCCTGAGCATCTCTTATAAAAGCTACACTCTCCTTTATAAAACAATAAGTGGCTTAGCTTAGAAAGTGATGTAATTTCAACTAATATTACAAGTGGATAAATATATGTCTATGAAATTCCTTAGCAAAAGAACTTCTTTTGGACACAAGTTAAATCTCCTATAGATGTACTTAGGGCTTAAAAGTTTTTATTAAATACATTGAACGTAAACTGCTAAATTTGGAATAAAAGTTATCATTAAAACTGGGAACATAGATAAGAAAGTGTCTTAATTGATACTTTATCATCAATAGATTAATCTGCTGATATAGGCCCTAATGTAGTTATATGTACAGGAGTTACAATCGGAAAAGGTGTTAGAATAAAAAACTCTATTATTTTAGAGGGTTCAATCATAAAAGATCACAGTTTTATAAGCGACAGTATTATAGGATGGCATAGTGAATTAGGGTATTGGAGCAGAGTAGAAGGCACTCCTGATGAAAAAGTTACTATATTAGGATGTGGTGTTAAGGTAGGTAATGAAGTTTCAATAAGAAACTGTGTTGTTTTAAAATAATAGTATTTATCTAGAAATTATAATGATTAATATATTATTTGCTGAAAAAACTATTAATGAATGTGCTAAGAATAAATAATAAGGATTTAAATAGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,445.4 L-2719.1 L-3578.1 S-0318.9 S-3491.3
S-6627.3 S-9512.0 S-12581.5 S-15630.3 S-24607.4
C-0556.4 C-2408.6 C-4823.5 C-61,598.1 C-81,288.5
C-10726.6 C-121,009.6 C-14593.4 C-16502.7 C-18298.1