Summary
Transcript IDgene_000003811
Gene IDTTHERM_00294580
Length1459 bp
Sequence
TAATTAAGACTTTATAAAATTACTTATAAAAAAGATACAATTTATTCTTGTAAAAATAAAAAAGGAATTAAAAATGTCAGAAGTGTCTCTCCTTCTTAAAAATATTGCGAAGGAAATAGGAAAAGATGAAAAAATCGTTTAGCCATTTATTAACATATTAGAGGATAATTTTTATGATACCATAGAATCAATTAAAGATCTTAAAACAGAAGACTATGAAAAATGGAAATTCCCTAAGCGTATAAGTGATTTGATAATTTAAAAAATATAAGAAACATTATAGGGTAAACCTCAATAAGGGCAGTAATCTGTCTAATCTAATGTCCAATAACAATAAACTTAGCAAAGTAACTAAGTCGTTACTTAATAATCTGAAATGGTTTCTGAACCATCAAAACAAGAATTAATTGTTCAAAAGCTTCAAGATTTGTAAAAAAGTATATCAACTACACAGCGTTATATTGACTTATTAAATTTTGTTAAGAAAATCATCTCAAATATAGCTGCAAATCCTAAAGAATAAAAATTCAGAAGAATCAAGCAATCCAACCAACACTTTTAAATAAACTTTTTGCCTAATAAAGAGGCATTAGAATTCATGTATTTAAACAATTTTAAGCTTGATGAAGAAGGTATATTCTTAGCAGATTAAGATTTAGATATAGAAACTTTGAATTTATCAATTATCAATATTGATAATGCTTTAATAGAAGCAACTCCTTCGAATTTCAATCCTTATTAAACTTATACTTCTGGCAATGAAGTACTTTGTGCTAGAAATTTAGCATAAAAAGAAGGATTTGTAAATTACTATGAAGAACTTTAGAAGCTAAAGGCTAAAAGATTATAAGTAATGTCATAGCCAGTTTCTGATAGAAAAACTAGAGTGTTTATTCAAAATCAAAATTAATCCAGATAAATGGAAATGTAAAATGAAGAAGTTGAAGAGAATTAATTACTCAGAGAATTTTCTGATTAATTAAAAAAAATGATTTAAAATTTAGACAAGCAGCAATTCTCATCGAAAAGTAAGCAAGAATATGAAAAATTGCTAAAAGATCCTGTTTACACAAAATCATTAATAAGAATTAAATTTCCTTAAAATGTTATTCTAGAAGGAAACTTTAGTCCTATGGAAACTATCAAGCATGTCATTGATTTTGTTGCCTTAAATTTAGAAAATCCAGAAGTACCATTCTACTTATTTTAATCTCCTCCTCGTCAAGTATTTGATAAAAGATTCCATCAAAAGACTCTTGATGAAATGGGATGCTTACCAGGAGCTGTTTTTTACTTTGCAATTGACAATGATCCAGAATTCTAAAAGAAATTCTATTTAAAAACAGAATTCAAATAATATTTATGAAAAATTACAGATATAAAAAACTAATGAAATTGTTTACATCTTTTATTTTTTTAAATAATCTTTTCAAATTAAAAATAATTTTATTAAGTAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1686.0 L-2894.7 L-3819.6 S-01,567.6 S-3771.7
S-6676.3 S-9815.0 S-12995.4 S-151,099.8 S-24883.4
C-0293.2 C-2455.0 C-4682.3 C-6510.5 C-8553.6
C-10723.6 C-12442.5 C-14554.9 C-16680.2 C-18811.5