Summary
Transcript IDgene_000003812
Gene IDTTHERM_00294560TTHERM_00294550
Length844 bp
Sequence
TTTTAATTTTTTCATAAAAAAAATATGTCAATATAGCCAGTTGAGTCGTAAATAAATTTTTAAAAGGAAATAGATGACTAGCTTCATGATGATTTTAGAAAGAACAAAATAAAACTAGATGTTTGGGTCTCGCTTAAAGTTATTAAAATTAGAGATTTGAATAAATATGAAACAATTGAAGTTTAGCCAACATAGACAATATAAGAAATCAGAGGAATTATATAAAGAATGATTTTAAAAGCGCTCAAAAATCCTACAGAAGATTAGAAATAAATTATTCAAGATTCTTACATTCTTTTAAGAGATAGATTTATTCCTTCTCCTTTCGAGAAGATTGGCGATTTGTATTGTATTTTTGGAGACAAAGAGAAAAAATCTATTTTATTATCTGTAGACTCCTTTGACGCTTAAGGATGATTAGCAAAAAGATAAATTAATTGATTGATTTATATAAAGGTTATTACAATAGTATTATATGTAAAATAAAGATGTTATGGAGTATATATCAATTTACAAATTTAATAATAAATAATTATTGATTTTTGAAATTATTTAAAAGAGTTAGTCGTTTGCCATATTATTTTATCACTTTTTATCTTTCTTTATTTTCTTTCCACTCTTTTTAGGAGATTTTGATTGAGATCTACTTCTGCTTCTCGAAGAGTTTTATTCCCTCTTTTCAGACTTATTTTTCTTACTTTTTTTGCTTGATTTTTATCTTTCATCATCACTCAAACTATCTGATTTTATCGAATTTTCAGAGGATGCAGATCTGCTTCTACTACTTGAGCGTGAGGATTCTGAATCAGAATCAGAAGAGGATTTACTTCTTTTCTTTTTTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1575.7 L-2590.6 L-3482.3 S-0848.4 S-3474.1
S-6623.2 S-9513.6 S-12446.2 S-15624.1 S-24558.2
C-0278.4 C-2649.6 C-4613.8 C-6635.6 C-8377.1
C-10511.3 C-12427.7 C-14414.7 C-16402.3 C-18353.8